ID: mmu-mir-6965
GENE: Ccnf(10)
chr17:24377779-24378028-


(1)
AGO.mut 		(1)
AGO1.ip 		(6)
AGO2.ip 		(1)
AGO3.ip 		(6)
B-CELL 		(11)
BRAIN 		(5)
CELL-LINE 		(1)
DCR.mut 		(11)
EMBRYO 		(12)
ESC 		(5)
FIBROBLAST 		(4)
LIVER 		(2)
LYMPH 		(10)
OTHER 		(5)
OTHER.mut 		(1)
PIWI.ip 		(2)
SKIN 		(7)
SPLEEN 		(13)
TESTES 		(3)
THYMUS 		(1)
TOTAL-RNA 		(1)
UTERUS

Sense strand
GCCACCGTCCGTGCTGCTTAGAGCAGAGCCCCGAGGCCAGGCTCCCTATTGGTCAGTTACCGAGCACTGGCTGCTTCTCAGCCTCATTTCTGCCGTGATCAGTCAGCACTGTGTACGACTGCTTGAGGGTCTAGGAGCGGGAGAGGGAGGCTATTGGGCAGGAGATGAGGAAGAACCTTCTGTGCTCGGTCTCGCTCCAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTGGAAGAGTCTTCTCG
...........................................................................................................................................((((...((((((...(((((..(((..(((.....)))))).))))))))))).))))....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT3()
Testes Data. (testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR073955(GSM629281)
total RNA. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjTestesWT2()
Testes Data. (testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR059771(GSM562833)
CD4_control. (spleen)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAG..................................................22144.0044.0014.003.003.00--1.00-1.00--1.00--1.00----1.001.00----2.00---1.00-2.001.001.001.001.00----1.00---1.00-----------------1.00------------1.00-------1.00-1.001.001.00----1.00-
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGT.................................................23131.0044.00-5.002.00--1.005.00--5.002.00--2.00---1.00---------------1.00--1.00---------1.00--------1.00--------1.00-1.00----1.00-----------1.00---------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGT.................................................21118.005.00--5.00---1.00------1.00------2.002.00------1.00--------1.00-1.00--1.001.00-----1.00------------------------------------------1.00
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTA................................................24110.0044.00----4.00---------2.00---1.00----------2.00----------------------------------------1.00----------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAG..................................................2119.009.006.00----1.00--------------------------------------1.00---------------------------1.00--------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCA...................................................2118.008.00-2.00-------------2.00----------2.00----------------------------------------------1.00--1.00----------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGT.................................................2218.009.00-----1.00--------------1.00--------------1.00------1.00-------1.00---1.00--------1.00-------------------------1.00---
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGA.................................................2317.0044.001.00------2.001.00-----1.00---1.00----------------------1.00---------------------------------------------------
.............................................................................................................................................................................AACCTTCTGTGCTCGGTCTCGCTCCAG..................................................2717.007.00---7.00-----------------------------------------------------------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAG..................................................2015.005.003.00------------------1.00------------------1.00------------------------------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGA.................................................2215.009.00------------4.00-----------------------------------------------1.00--------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCAGGC...........................2514.004.00----4.00----------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCATT.................................................2313.008.00-------1.00--------1.00----1.00-----------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAT..................................................2213.008.00----------------1.00-----------------------------------1.00----------------------1.00-----------------
...................................................................................................................................................................................................................AAGGAAGCAGGCGCGCAA.....................183.000.00----------------------1.00------------------------------------------------------1.00---------1.00-----
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGA.................................................2113.005.00--------1.00-----------------------------------1.00---------------------------------------------1.00--
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGAGA.....................................................................................2413.003.00-1.00---1.00-----1.00---------------------------------------------------------------------------------
.................................................................................................................................................................GAGATGAGGAAGAACCTTCTGTGCT................................................................2512.002.00-----------2.00---------------------------------------------------------------------------------
..........................................................ACCGAGCACTGGCTGCTTCTCAGCCTC.....................................................................................................................................................................2712.002.00--------2.00------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCC....................................................2012.002.00-----------1.00---------------1.00-----------------------------------------------------------------
.................................................................................................................................................................................TTCTGTGCTCGGTCTCGCTCCAG..................................................2312.002.00--------------------------------------1.00--------------------------1.00---------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAT...............................................2512.0044.00-------------------------------------1.00---------------1.00---------------------------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGCAGGCGCGTA......................2612.002.00-------------------------1.00------------------------------1.00------------------------------------
...................................................................................................................................................................................................................AAGGAAGCAGGCGCGCAAA....................192.000.00-------------------1.00--1.00----------------------------------------------------------------------
.............................................................................................................................................................................AACCTTCTGTGCTCGGTCTCGCTCAAG..................................................271.000.00---1.00-----------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAAA.................................................2311.008.00---------------------------------------------------------1.00-----------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGTAG...............................................2411.009.001.00--------------------------------------------------------------------------------------------
............................................................................................................................................GAGAGGGAGGCTATTGGGCAGC........................................................................................221.000.00--------------------------------1.00------------------------------------------------------------
............................................................................................................................................................................................................AAGAGAAAAGGAAGCAAGCA..........................201.000.00---------------------------------------------1.00-----------------------------------------------
....................................................................................................................................AGGAGCGGGAGAGGGATG....................................................................................................181.000.00-----------------------------------------------1.00---------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCAGG............................2411.001.00--------------------------------------------------------------------1.00------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCAAGT.................................................211.000.00--------------------------------------------------------------1.00------------------------------
......................................................................................................................CTGCTTGAGGGTCTAGGAGC................................................................................................................2011.001.00-------------------------------------------------------------------------------1.00-------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAA.................................1911.001.00---------------------------1.00-----------------------------------------------------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGCAGGCGCGTAG.....................2711.001.00---------------------------------------------------------------------1.00-----------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGC.......................................................1711.001.00-----1.00---------------------------------------------------------------------------------------
...........................................................................................GCCGTGATCAGTCAGCACTGT..........................................................................................................................................2111.001.00----------------------------------1.00----------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGATAA....................................................................................251.000.00-----------------1.00---------------------------------------------------------------------------
.................................................................................................................................................................................................................AAAAGGAAGCAGGCGCGCAA.....................201.000.00-----------------------1.00---------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTC.....................................................1911.001.00----------1.00----------------------------------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAG.........................................................................................2011.001.00-----------------1.00---------------------------------------------------------------------------
......GTCCGTGCTGCTTAGAGCAGA...............................................................................................................................................................................................................................2111.001.00-----------------------------------1.00---------------------------------------------------------
................................................................................................................................................................................................................GAAAAGGAAGCAGGCGCGTAGCCTTT................2611.001.00--------------------------------------------------------------------------------1.00------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCCAGTA................................................2311.009.00---------------1.00-----------------------------------------------------------------------------
............................................................................................................................................GAGAGGGAGGCTATTGGGCAGGAGATGAGGA...............................................................................3111.001.00---1.00-----------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAG...............................................2511.0044.001.00--------------------------------------------------------------------------------------------
..........................................................................................................................................................................................................CGAAGAGAAAAGGAAGC...............................1711.001.00-----1.00---------------------------------------------------------------------------------------
...................................................................................................................................................................................................................................AGCCTTTTGGAAGAGTCTTCTC.2211.001.00-----------------------1.00---------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAGCA..............................2211.001.00-------------------------1.00-------------------------------------------------------------------
....................................................................................................................................................................................TGTGCTCGGTCTCGCTCCAGATT...............................................2311.005.00-----------------------------------------1.00---------------------------------------------------
...................................................................................................................................................................................CTGTGCTCGGTCTCGCTCC....................................................1911.001.001.00--------------------------------------------------------------------------------------------
..............................................................................................................GTGTACGACTGCTTGAGGGT........................................................................................................................2011.001.00--------1.00------------------------------------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAGGAG......................................................................................2311.001.00---------------------------------------------------------------------------------1.00-----------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGAA................................................2411.0044.00----------------1.00----------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGGAAG................................2011.001.00------------------------------------------------------------------------------1.00--------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAAAA................................................2411.008.00-------1.00-------------------------------------------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGTAA...............................................2511.0044.00-------------------------------1.00-------------------------------------------------------------
.....................................................................................................................................................................TGAGGAAGAACCTTCTGTCGT................................................................211.000.00----------------------------------------1.00----------------------------------------------------
..................................................................................................................................................................................TCTGTGCTCGGTCTCGCTCCAGATT...............................................2511.0044.00------------------------------------------------1.00--------------------------------------------
.................................................................................................................................................................................TTCTGTGCTCGGTCTCGCT......................................................1911.001.00---------------------------------------------------1.00-----------------------------------------
......................................................................................................................................................................................TGCTCGGTCTCGCTCCAGT.................................................191.000.00------------------------------------1.00--------------------------------------------------------
.............................................................................................................................................AGAGGGAGGCTATTGGGCAT.........................................................................................201.000.00-------------------------------------------------------------------1.00-------------------------
..............................CCGAGGCCAGGCTCCCTATTG.......................................................................................................................................................................................................2111.001.00-----1.00---------------------------------------------------------------------------------------
......................................................................................................................................................................................................AGGACGAAGAGAAAAGG...................................1720.500.50--------------0.50------------------------------------------------------------------------------
....................................................................................................................................................................................................................AGGAAGCAGGCGCGTAG.....................1720.500.50----0.50----------------------------------------------------------------------------------------
.............................................................................................................................................................GCAGGAGATGAGGAAGAA...........................................................................1840.250.25---------------------------------------------0.25-----------------------------------------------

Antisense strand
GCCACCGTCCGTGCTGCTTAGAGCAGAGCCCCGAGGCCAGGCTCCCTATTGGTCAGTTACCGAGCACTGGCTGCTTCTCAGCCTCATTTCTGCCGTGATCAGTCAGCACTGTGTACGACTGCTTGAGGGTCTAGGAGCGGGAGAGGGAGGCTATTGGGCAGGAGATGAGGAAGAACCTTCTGTGCTCGGTCTCGCTCCAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTGGAAGAGTCTTCTCG
...........................................................................................................................................((((...((((((...(((((..(((..(((.....)))))).))))))))))).))))....................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		mjTestesWT3()
Testes Data. (testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR059775(GSM562837)
MEF_Drosha. (MEF)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		GSM361407(GSM361407)
CGNP_P6_Ptc+-_Ink4c--_rep5. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR073955(GSM629281)
total RNA. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjTestesWT2()
Testes Data. (testes)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		GSM361415(GSM361415)
WholeCerebellum_P6_p53--_Ink4c--_rep4. (brain)		SRR059771(GSM562833)
CD4_control. (spleen)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
.....................................................................................................................................................................................GTGCTCGGTCTCGCTCCAGCGC............................................... 222.000.00-----------------------------------------------------------1.00----------------------------1.00----
..................................................................................................................................CTAGGAGCGGGAGAGGGAT..................................................................................................... 191.000.00----------------------------------------------------------1.00----------------------------------
............................................................................................CCGTGATCAGTCAGCAAG............................................................................................................................................ 181.000.00----------------------------------------1.00----------------------------------------------------
..............................................................................................................................................................................................................................CGCGTAGCCTTT................ 1270.140.14---------------------------------------------0.14-----------------------------------------------