ID: mmu-mir-6958
GENE: Fam116b(13)
chr15:89015845-89016017-


(1)
AGO.mut 		(3)
AGO1.ip 		(21)
AGO2.ip 		(2)
AGO3.ip 		(8)
B-CELL 		(48)
BRAIN 		(7)
CELL-LINE 		(3)
DCR.mut 		(3)
DGCR8.mut 		(16)
EMBRYO 		(12)
ESC 		(7)
FIBROBLAST 		(4)
HEART 		(7)
LIVER 		(1)
LUNG 		(3)
LYMPH 		(12)
OTHER 		(6)
OTHER.mut 		(3)
PIWI.ip 		(1)
PIWI.mut 		(7)
SKIN 		(4)
SPLEEN 		(11)
TESTES 		(2)
THYMUS 		(6)
TOTAL-RNA 		(1)
UTERUS

Sense strand
GGACCCCAGCTCACCTGCATCCTCAAGGGTGACTGGCTGGGCCTCTACAGGTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGGCGGTTTTTCAAGTCCCCCCATTTTGATGGCTGGTATCGGCAACGACACA
..................................................(((((..(((((((.((((.(((.((.....(((......)))..))))).)))).))))))).))..)))....................................................
..................................................51......................................................................123................................................
SizePerfect hitTotal NormPerfect NormSRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		mjTestesWT1()
Testes Data. (testes)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR206941(GSM723282)
other. (brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR206939(GSM723280)
other. (brain)		SRR206942(GSM723283)
other. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		mjTestesWT3()
Testes Data. (testes)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR060845(GSM561991)
total RNA. (brain)		GSM640576(GSM640576)
small RNA in the liver with paternal low prot. (liver)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM566419(GSM566419)
"Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection". (fibroblast)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)
....................................................................................................TCAGCTGCCTCTTGCCATCACAGT.................................................241383.00201.0029.0022.0028.0016.0020.006.0026.00-14.0019.0010.006.0011.0015.007.002.002.003.005.001.008.003.006.002.00-7.007.004.002.003.00-8.001.002.005.001.002.003.003.001.00-4.002.004.002.001.001.002.00-5.00---2.003.001.001.00---2.003.004.002.001.00--1.00----2.001.001.00-1.001.00--1.001.00-1.002.00-1.001.00---2.002.002.00---1.00--1.001.00--------1.00-1.00--1.001.001.00-----1.001.00--1.00-------------1.00----1.00---------
....................................................................................................TCAGCTGCCTCTTGCCATCACAG..................................................231201.00201.0013.006.0013.009.005.0021.00--9.00-4.0010.007.00-8.004.004.007.002.006.002.004.003.009.00----1.001.007.00-4.005.00-1.003.00---1.00-3.00--3.002.003.005.00----1.00-1.001.00----------1.00----1.00---1.00-----------2.00-2.00-----------1.00-----------------1.00-------1.00---1.00--1.00---------1.00----------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGA.................................................241101.00201.0028.001.005.0016.0015.007.00---2.002.00-1.00-----2.004.00---------------3.00---4.00-------------1.001.001.002.00-1.00--------1.00---------------------1.00----1.00--------------1.00------------------------------1.00---------------
..................................................GTGGGAGAAGAGGCTGCTGTGG.....................................................................................................22161.0061.00-7.001.00-2.002.00-29.00-1.00---1.00-3.00-----------1.001.00--------1.00-1.00----1.00-----1.00-----------------1.00---------1.00-1.00--1.00-1.00-------------------1.00-------1.00----1.00-------------------------1.00-----------
....................................................................................................TCAGCTGCCTCTTGCCATCACA...................................................22158.0058.003.006.00-2.001.005.00--1.00--1.001.002.00--1.001.001.001.00-4.001.001.0010.00-1.00-----1.00---1.00-3.00-----2.001.00------1.00-----1.00-1.00--------------1.00-----1.00-----1.00--------------------------------------1.00-----------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAC....................................................21121.0021.00-1.00------1.003.00-1.00----2.00-----2.00--2.00-1.001.00-1.00---1.00------------------------------1.00---------1.00----------------------------------------------------------1.00------------1.00-----1.00--
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTT................................................25117.00201.001.002.002.003.00--1.00-1.00---------1.00-1.00--------------1.00-1.00---------------------------------------------------1.00------1.00---------------------------------------------------1.00-------
..................................................GTGGGAGAAGAGGCTGCTGTG......................................................................................................21113.0013.00----1.00------------------------2.00----------1.00----------2.00-------2.00-------------------1.00--1.00---------------------------------------1.00--------------------1.00--------1.00---
....................................................................................................TCAGCTGCCTCTTGCCATCA.....................................................20112.0012.00-----1.00--1.00-------3.00------------1.00-----------2.00----1.00-----1.00------------------------1.00-------------------------------------------1.00----------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGC.................................................2419.00201.003.00-1.001.002.00-1.00--------------------1.00--------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGT.....................................................................................................2217.0013.00-----------------1.00--------------------------------1.00--------1.00--------1.00---------1.00-----------------------------------------------------------1.00------------1.00----
..................................................GTGGGAGAAGAGGCTGCTGTGA.....................................................................................................2217.0013.00-1.001.00------------1.00---------------------1.00--1.00------------------1.00-----------------------------------1.00------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATC......................................................1915.005.00------1.00----------------------1.00--1.00-1.00---------------------------------------------------1.00---------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGT.......................................................................................................2014.004.00----------------------------1.00----------------------------------------1.00---------1.00---------------1.00------------------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACAGT.................................................2214.003.00------2.00----------1.00-------1.00----------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCGA.................................................2414.0021.00---------------------------------------------------------4.00--------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCGT.................................................2414.0021.00---------------------1.00--------------------1.00---------------2.00-------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGA....................................................................................................2314.0061.00-1.00------------------------------------------------1.00-----------------1.00--------------------------------------------------------1.00------------------------------
.................................TGGCTGGGCCTCTACAG...........................................................................................................................1714.004.00-----------------------------------------------------------------------3.00----------------------------------------------------------1.00-------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAT..................................................2314.0058.00---1.001.00-----------1.00--------------------------1.00----------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAA....................................................................................................2314.0013.00-----1.00----------------------------------1.00------------------------2.00------------------------------------------------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGTGG.....................................................................................................2113.003.00-------3.00----------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGG....................................................................................................2313.003.00-----------1.00--------------------1.00---------------------------------------------------------------------------------------------------------------------1.00-----
....................................................................................................TCAGCTGCCTCTTGCCATCACATT.................................................2413.0058.001.00-1.00--------------------------1.00------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGG.................................................2413.003.00-----1.001.00--------1.00--------------------------------------------------------------------------------------------------------------------------------------------
.....................................................................................................CAGCTGCCTCTTGCCATCACAGT.................................................2313.001.00-------------------------------------------------------------1.00--2.00-------------------------------------------------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACAG..................................................2113.003.00------1.00--------------------------------------------------------2.00--------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAA..................................................2313.0058.00------1.00---------------------2.00-------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTTT...............................................2613.00201.00----------1.00---------1.00----------------------------------------------------------------------------------------------------------------------1.00----------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAA................................................2512.00201.00---2.00--------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAGA...................................................................................................2412.0013.00---------------2.00--------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACC...................................................2212.0021.00---------------------------------------------------------------------------------------------------------------1.00-------------------1.00------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATC......................................................2212.002.00-2.00----------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCAC....................................................2412.002.00-2.00----------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCT.....................................................2312.002.00-1.00-----------------------------------------------------1.00----------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTTT.....................................................................................................2212.004.00----------------------------------------1.00--------------------------------------------------------------------------------------------1.00----------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTC................................................2512.00201.00----------2.00-------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGT....................................................................................................2312.0061.00--------------------------------------------------1.001.00--------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGAAA..................................................................................................2512.0061.00------------------------------1.00---------1.00-------------------------------------------------------------------------------------------------------------------
...................................................................................................CTCAGCTGCCTCTTGCCATCACA...................................................2312.002.00------------------------------------------------------------------2.00-----------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCA........................................................1721.501.50--------------------------0.501.00--------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGTAT...............................................761.000.00----------------------------------------------------------------------1.00-------------------------------------------------------------------------------------
..............................................................................................................................GTTTTTCAAGTCCCCGGC.............................181.000.00---------------------------------------------------------------------------------------------------1.00--------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGGTGT.......................................................................................................201.000.00---------------------------------------------------------------------1.00--------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAAAGA.................................................2411.0012.00----------------------------1.00-------------------------------------------------------------------------------------------------------------------------------
....................CCTCAAGGGTGACTGCGTA......................................................................................................................................191.000.00---------------------------1.00--------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGGGGC....................................................................................................231.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------1.00------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACA...................................................7211.001.00----------------------------------------------------------------------1.00-------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGGA................................................................................................2711.001.00---------------------------------------------------1.00--------------------------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAG..................................................1911.001.00-----------1.00------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................CTGCTGTGGGTGCCCTGCC...........................................................................................191.000.00------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAAAG..................................................2311.0012.00----------------------------------------------1.00-------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGCT................................................2511.00201.00----1.00-------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGAATT....................................................................................................231.000.00-------------------------------------------------------------------------------------------------------1.00----------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAAG.................................................2411.0058.00---------------------------------------------------------------------------------------------------------------------------------1.00--------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACCG..................................................2311.0021.00------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------
...................................................................................................................................................TGATGGCTGGTATCGGCAACGACACAATT291.000.00------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTAGA....................................................................................................2311.004.00--------------------------------------------------------------------------1.00---------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAT................................................2511.00201.00----------------------------------------------------------------------------------------------1.00-------------------------------------------------------------
...................................................................................................CTCAGCTGCCTCTTGCCATCACAGT.................................................251.000.00--------------------------------------------------------------------------------------------------1.00---------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAGAA..................................................2311.0012.00-----1.00------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACACT.................................................2411.0058.00------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGTGGGTGC.................................................................................................2511.001.00----------------------------------------------------------------------------------------------------------------------------------------1.00-------------------
.......................................................................................................................................................GGCTGGTATCGGCAACGAC...1911.001.00---------------------------------1.00--------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCATTT..................................................2311.0012.00----1.00-------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TTTGATGGCTGGTATAA...........171.000.00---------------------------------------------------------------------1.00--------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGC.................................................................................................2611.001.00--------------------------------------------------------------------------------------------------------1.00---------------------------------------------------
...................................................TGGGAGAAGAGGCTGCTGGGG.....................................................................................................211.000.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATTT.....................................................231.000.00--1.00---------------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTTTGG.....................................................................................................221.000.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCAGGG..................................................2311.0012.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACGGT.................................................2411.0021.00----------1.00-------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCCCA...................................................721.000.00----------------------------------------------------------------------1.00-------------------------------------------------------------------------------------
................................CTGGCTGGGCCTCTACAG...........................................................................................................................1811.001.00------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACATA.................................................2411.0058.00---1.00--------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGTTG...............................................2611.00201.00------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCATT...................................................2211.0012.00---------------1.00--------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACAGAAT...............................................2611.00201.00----------------------------------------------------------------------------------------------------------------------------------------------1.00-------------
..................................................GTGGGAGAAGAGGCTGCTGTGGTAG..................................................................................................2511.0061.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAGT.................................................2011.001.00-------------------------------------1.00----------------------------------------------------------------------------------------------------------------------
............................................CTACAGGTGGGAGAACGC...............................................................................................................181.000.00-----------------------------------------------------------------------------------------------------------------------------------------1.00------------------
........................AAGGGTGACTGGCTGGGCC..................................................................................................................................1911.001.00-----------------------------------------------------------------------------------------------------------------------1.00------------------------------------
.......................CAAGGGTGACTGGCTGGGCCTCTACA............................................................................................................................2611.001.00----------------------------------------------------1.00-------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGGGTG..................................................................................................2511.001.00-----------------------------------------------------------------------------------------------------------1.00------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCACG...................................................2211.0021.00-------------------------------------------------------------------------1.00----------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCCATCACT...................................................2511.002.00--------------------------1.00---------------------------------------------------------------------------------------------------------------------------------
........................AAGGGTGACTGGCTGGGCCTCTACAGGC.........................................................................................................................281.000.00----------------------------------------------------------------------------------1.00-------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCATCATAGT.................................................2411.0012.00----------------------------------------------------1.00-------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGTGAT....................................................................................................2311.0013.00-------------------------------------------------------------------------------------1.00----------------------------------------------------------------------
.....................................................................................................CAGCTGCCTCTTGCCATCACAG..................................................2211.001.00------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------
........................................................................................................CTGCCTCTTGCCATCACAGTGCT..............................................2311.001.00------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------
..................................................GTGGGAGAAGAGGCTGCTGA.......................................................................................................201.000.00----------------------------------------------------------------------------------------------------------1.00-------------------------------------------------
......................................................................................................AGCTGCCTCTTGCCATCACA...................................................2011.001.00-----------------------------------1.00------------------------------------------------------------------------------------------------------------------------
.................................................................................................TCCTCAGCTGCCTCTTGCC.........................................................1911.001.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCC.........................................................1640.500.50------0.50-----------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................TCAGCTGCCTCTTGCCCTC......................................................1940.250.50------0.25-----------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
GGACCCCAGCTCACCTGCATCCTCAAGGGTGACTGGCTGGGCCTCTACAGGTGGGAGAAGAGGCTGCTGTGGGTGCCCCCAAGTCCGCTAGCTCAGCTCCTCAGCTGCCTCTTGCCATCACAGGCGGTTTTTCAAGTCCCCCCATTTTGATGGCTGGTATCGGCAACGACACA
..................................................(((((..(((((((.((((.(((.((.....(((......)))..))))).)))).))))))).))..)))....................................................
..................................................51......................................................................123................................................
SizePerfect hitTotal NormPerfect NormSRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		mjTestesWT1()
Testes Data. (testes)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR206941(GSM723282)
other. (brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR206940(GSM723281)
other. (brain)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR394083(GSM855969)
"background strain: C57BL6/SV129cell type: KR. (cell line)		SRR206939(GSM723280)
other. (brain)		SRR206942(GSM723283)
other. (brain)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR306536(GSM750579)
19-24nt. (ago2 brain)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR306543(GSM750586)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		SRR306532(GSM750575)
19-24nt. (ago2 brain)		GSM510454(GSM510454)
newborn_rep10. (total RNA)		SRR023848(GSM307157)
mEFsmallrna_rep1. (cell line)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR095853(SRX039174)
"sequencing of miRNA from wild type and disea. (heart)		GSM510455(GSM510455)
newborn_rep11. (total RNA)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		mjTestesWT3()
Testes Data. (testes)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306529(GSM750572)
19-24nt. (ago2 brain)		SRR037904(GSM510440)
brain_rep1. (brain)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR038740(GSM527275)
small RNA-Seq. (dicer brain)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		GSM510452(GSM510452)
newborn_rep8. (total RNA)		SRR037927(GSM510465)
e7p5_rep1. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR028732(GSM400969)
Mili-Tdrd1 KO associated. (mili testes)		SRR034118(GSM466728)
Mili IP_Tdrd9+/- replicate1. (mili testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR059772(GSM562834)
CD4_Drosha. (spleen)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR060845(GSM561991)
total RNA. (brain)		GSM640576(GSM640576)
small RNA in the liver with paternal low prot. (liver)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR525242(SRA056111/SRX170318)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR037910(GSM510447)
newborn_rep3. (total RNA)		GSM317183(GSM317183)
Ago-1 IP small RNAs from mouse brain. (ago1 brain)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		RuiDcrWT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR306530(GSM750573)
19-24nt. (ago2 brain)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		GSM566419(GSM566419)
"Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection". (fibroblast)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR065053(SRR065053)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR073955(GSM629281)
total RNA. (blood)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)
.........................................................................TGCCCCCAAGTCCG...................................................................................... 1450.600.60----------------------------------------------------------------------------------------------------------------------------------------------------------0.400.20
..........................................................................GCCCCCAAGTCCG...................................................................................... 13100.100.10----------------------------------------------------------------------------------------------------------------------------------------------------------0.10-