ID: mmu-mir-6942
GENE: Zkscan3(3)
chr13:21488397-21488646-


(2)
AGO1.ip 		(13)
AGO2.ip 		(2)
AGO3.ip 		(11)
B-CELL 		(29)
BRAIN 		(4)
CELL-LINE 		(2)
DCR.mut 		(3)
DGCR8.mut 		(8)
EMBRYO 		(5)
ESC 		(4)
FIBROBLAST 		(3)
HEART 		(3)
KIDNEY 		(10)
LIVER 		(5)
LYMPH 		(25)
OTHER 		(4)
OTHER.mut 		(4)
PIWI.ip 		(1)
PIWI.mut 		(8)
SKIN 		(8)
SPLEEN 		(20)
TESTES 		(1)
THYMUS 		(1)
UTERUS

Sense strand
TTAGGGTCTTCTGACTTACATTCAGTCTCTCCAGAACACCCTCACAGACATTTATGATTCTAAGTCCCACAAGATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCCTGGGCCTAGGAGGAGGGGAACATTTGCAACTATAGTGGCTTATGGTTCTCTCCACCTCTCAGTAGTCTTTTACAGAAATACAACTCACAGCTACAGTGAAACGGGAGAACTG
...........................................................................................................................................(((...(((.((((((((.(((..((.((....)).))..))).)))))))).))))))....................................................
...........................................................................................................................................140.........................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjLiverWT2()
Liver Data. (liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		mjTestesWT2()
Testes Data. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR206941(GSM723282)
other. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR206942(GSM723283)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		mjTestesWT3()
Testes Data. (testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR206939(GSM723280)
other. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)
................................................................................................................................................TAGGAGGAGGGGAACATTTGC.....................................................................................211181.00181.0048.007.009.00-1.0011.006.001.005.005.00-1.00--3.00--4.001.002.00-5.002.001.002.005.00-3.002.001.002.002.002.00-2.00-1.001.00-2.003.00-1.002.00---1.00--1.00-3.00-1.003.003.001.001.001.00-1.00-1.00-3.002.00--1.00-----1.00-1.00----1.00-1.00-1.00-1.00---1.00---1.00------1.00-------1.00-1.00-1.00--1.00------1.00--------1.00----------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGC.....................................................................................22179.0079.006.003.00-19.001.00-5.001.001.00---1.00-4.00--1.003.00---1.00-4.00-1.001.002.00-2.00--1.00-1.00--1.002.00-3.00-1.00------3.00------1.00--1.00-----1.00-1.00---------------------2.001.00--------1.00--------------------------1.001.00--1.00-------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGA.....................................................................................21165.0037.0011.0015.003.00-6.00---1.004.005.00--------1.001.00-----1.002.001.001.00----1.00-2.002.00--1.00-1.001.00-------------1.001.001.00----------------------------------------------------1.00----1.00---------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTG......................................................................................20137.0037.001.007.00---2.001.00-1.002.00-2.00------1.001.00----1.00--------1.00-3.001.001.001.00-----4.002.00---------------------1.00-1.00------------------1.00---1.00--------1.00-------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGC.....................................................................................23132.0032.005.00-8.00-1.002.00-1.002.00-2.001.00-----1.00-1.00--1.00------1.00---------1.00-----------1.00-1.00----1.00---------------------------------------1.00---------1.00------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTT.......................................................................................19113.0013.001.00------2.00----2.00--2.00----1.00------------1.00--------------------------2.00-1.00-------------------------------------------------------------------------1.00--------
................................................................................................................................................TAGGAGGAGGGGAACATTTGT.....................................................................................21113.0037.001.00-------1.00---1.00--2.00--1.001.00-------------------------1.00---1.00-------------------------------------1.00------------------1.00----------------------------1.00--1.00------
...............................................................................................................................................CTAGGAGGAGGGGAACATTT.......................................................................................20113.0013.00-1.00-----2.00----2.00--2.00--1.00-1.00-------------------------1.00---------------1.00-----------------------1.00------------------------------------1.00---------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGA.....................................................................................22112.008.002.003.00---------------------------1.00-------------------1.00--------------------1.002.00------1.00---------------------------------------------------1.00--------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAA....................................................................................22111.0037.00-2.00--1.00-3.00-------------------------------1.00-1.00--------1.00-----------------------------------1.00-------------------1.00---------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACAGCT....................21111.0011.00----------------6.00------3.00-----------------------1.00-----1.00-------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTG......................................................................................22110.0010.00----1.00--------------1.001.00---------------------1.00------1.00-----------1.00----------1.00------------------------1.00---------------------1.00-1.00-----------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCA....................................................................................2219.009.00--------1.00-5.00--------------1.001.00------------------------1.00---------------------------------------------------------------------------------------------
..............................................................................................................................................................................................................TTTACAGAAATACAACTCACAGCTACAG................2818.008.00-------------8.00-----------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTG......................................................................................2118.008.00-------1.00----1.00-----1.00-------1.00----1.00------1.00-----------------------------------------1.00-------------------------------------------------------------1.00--
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGT.....................................................................................2216.008.00---------------1.00-----------------1.00-------1.00---1.00--------1.00------------1.00-----------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTT.......................................................................................2116.006.00---------------------------------1.00------------------------------1.00-----1.00-----1.00----1.00-------------------------------------------------------1.00-------
..................................................................................................................................................................................TATGGTTCTCTCCACCTCTCAGA.................................................235.000.00---------------------2.001.001.00------------------------------1.00------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAA...................................................................................2314.004.00-------1.00-------------------------------------------1.00-----------1.00-----------------1.00---------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAA...................................................................................2314.0037.00-1.00-------1.00-1.00-----------------------------------------------------------------------------------------------------------------------------------1.00-
......................................................................................................................................................................................................................................ACAGTGAAACGGGAGAACT.1914.004.00-----------3.00--------------------------------------------------------------------1.00----------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCA....................................................................................2313.003.00----1.00--------------------------1.00--------------------------------------------------------------1.00--------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTAA.....................................................................................2113.0013.00-------2.00--------------------------------------------------------1.00--------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCAA...................................................................................2413.003.001.00-------------------------------------------------------------------1.00-------1.00--------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAA....................................................................................2313.008.001.00----1.00---------------------------------------------------------------------1.00---------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGTA....................................................................................2213.0037.002.00-------1.00----------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAT...................................................................................2313.009.001.00---1.00----------------------------------------------------------------------------------1.00---------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCT....................................................................................2413.0032.001.00----------1.00---------------------------------------------------------------------------------------------------------------------1.00---------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAT...................................................................................2313.0037.00-1.00----------------------------2.00------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGA.....................................................................................2313.0010.001.00---1.00-----------------------------------------1.00--------------------------------------------------------------------------------------------------
........................................................................GATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCC................................................................................................................6612.002.00-----------------------------------------------------------------------------------------2.00-------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCT....................................................................................2212.00181.00--------------1.00-------1.00--------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTC....................................................2112.002.00-------------------------------------1.00---------------------1.00-------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTTC.....................................................................................2112.0013.00--1.00-----------------------------1.00----------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTT......................................................................................2212.006.00-------2.00-----------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATT........................................................................................1912.002.001.00--------------1.00---------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACAT.........................................................................................1812.002.00--------------------1.00---------------------------------------------------------------------------------------------------1.00------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCTA...................................................................................2312.00181.00------------------------------------------1.00-----------------------------------------1.00------------------------------------------------------------
................................................................................................................................................................................................................TACAGAAATACAACTCACAGCTACAGTGA.............2912.002.00--------------------------------------------------------------------------1.00----1.00-----------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTC......................................................1912.002.00-----------------------------------------------------------------------------------2.00-------------------------------------------------------------
..................................................................................................................................................................................................................CAGAAATACAACTCACAGCTACAGTGAAACGGT.......332.000.00----------------------------------2.00--------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TATGGTTCTCTCCACCTCTCAGT.................................................2312.002.001.00-----------------------------------------------------------------------------------------------------------------------------1.00------------------
................................................................................................................................................TAGGAGGAGGGGAACATTGGC.....................................................................................2112.001.002.00------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACAGC.....................2012.002.00-----------------------1.00-----------------------1.00-------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATT........................................................................................2012.002.00-------1.00---------------------------------------------------------------------------------------------------1.00-------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCTT...................................................................................2312.00181.00----1.00------1.00-------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................TTTTACAGAAATACAACTCACAGCTACA.................2811.001.00--------------------------------------------------------------------------------------------------------------------------1.00----------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCTT...................................................................................2411.0079.00--------------------------1.00----------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACAT.........................................................................................1911.001.00-----------------------------------------------------------------------------------------------1.00-------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTA......................................................................................2211.006.00-------------------------------------------------------------------------1.00-----------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCT.....................................................2011.001.00-------------------1.00-----------------------------------------------------------------------------------------------------------------------------
...................ATTCAGTCTCTCCAGAACACCCTC...............................................................................................................................................................................................................2411.001.00-------------------------------------------------------------------------------------1.00-----------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATA........................................................................................1911.002.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAG...................................................................................2311.0037.001.00------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................GGGGATCTCCTCAGCTG.........................................................................................................................................1711.001.00-------------1.00-----------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTTT.....................................................................................2111.0013.00---------------1.00---------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCT....................................................................................2311.0079.00--------------------------1.00----------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAAT.................................................2411.001.00-------------------------------------------------------------------------------------------------------------1.00-----------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTAA......................................................................................2111.002.00--------------------------------------1.00----------------------------------------------------------------------------------------------------------
................................................................................................GGGGATCTCCTCAGCTGCGGC.....................................................................................................................................211.000.00-------------1.00-----------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCAA...................................................................................2511.001.00-------------------------------------------------------------------------------------------1.00-----------------------------------------------------
........................................................................................................................................................................................................................TACAACTCACAGCTACAGTGAAACGGGA......2811.001.00---------------------------------------------------------------------------------------------------------------------------------------------1.00---
................................................................................................................................................TAGGAGGAGGGGAACATTAA......................................................................................2011.001.00----------------------------------------------1.00--------------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGCTC...................................................................................2511.0032.00------------------------------------------------------------------------1.00------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATT........................................................................................1811.001.00------------------------------------1.00------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGTT....................................................................................2211.0037.00--------------------1.00----------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................GCCTAGGAGGAGGGGAACAT.........................................................................................2011.001.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................AGAAATACAACTCACAGCT....................1911.001.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................AGGAGGAGGGGAACATTTG......................................................................................1911.001.00-----------------------------------------------------------------------------1.00-------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTTCT....................................................................................2311.0013.00--------------------------------1.00----------------------------------------------------------------------------------------------------------------
.......................................................................................................................................TCCTGGGCCTAGGAGGAGGGGAACAT.........................................................................................2611.001.00--------------------------------1.00----------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGG..............................................................................................2011.001.00--------------------------------------------------------------1.00----------------------------------------------------------------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAGAAT...............................................261.000.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGAAC...................................................................................2311.0037.001.00------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTGGC.....................................................................................2211.002.00--------------1.00----------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................TACAACTCACAGCTACAGTGAAACGG........2611.001.00---------------------------------------------------------------------------------------------------1.00---------------------------------------------
...................................................................................................................................................................................................................................GCTACAGTGAAACGGGAGAACT.2211.001.00-------------------------------------------------------------------------------------------------------------------------------------------1.00-----
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCAGT.................................................2411.001.00---------------------------------------------------------------------------------------------1.00---------------------------------------------------
.....................................................................................................................................................................................GGTTCTCTCCACCTCTCAGTAG...............................................2211.001.00-------------------------------------------------------------1.00-----------------------------------------------------------------------------------
.............................................................................................................................................GCCTAGGAGGAGGGGAACATTTGCT....................................................................................251.000.00--------------------------------------------------------------------------------------------------------------1.00----------------------------------
........................................................ATTCTAAGTCCCACAAGATGACACAGAG......................................................................................................................................................................2811.001.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................AAATACAACTCACAGCTACAGTGAAACGGGA......3111.001.00--------------------------------------------------------------------------1.00----------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTC......................................................................................2011.0013.00--------------------------------------------------------------------------------------------------------------------------------------------1.00----
................................................................................................................................................TAGGAGGAGGGGAACATTTAT.....................................................................................2111.0013.00--------------------------------------------------------------------------------------------------------1.00----------------------------------------
...........................................................................................................................GTTTCCTTGGAGTCCAGT.............................................................................................................181.000.00--------------------------------------------------------------------------------------------------------------------1.00----------------------------
.................................................................................................................................................................................TTATGGTTCTCTCCACCTCTCA...................................................2211.001.00-----------------------------------1.00-------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................................................AGCTACAGTGAAACGGG.......1711.001.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AATACAACTCACAGCTACAG................2011.001.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACAT.........................................................................................2511.001.00----------------------------------------------------------------------------------------------------------------------------1.00--------------------
..................................................................................................................................................................................................................CAGAAATACAACTCACAGCT....................2011.001.00-----------------------------------------------------1.00-------------------------------------------------------------------------------------------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTGT.....................................................................................2311.0010.00--------------------1.00----------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACATT........................................................................................2611.001.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAACTATAGT............................................................................3011.001.00------------------------------------------------------------------------------------------------------------------1.00------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGCAGA..................................................................................2511.003.00---------------------------------------------------------------1.00---------------------------------------------------------------------------------
.................................................................................................................................................AGGAGGAGGGGAACATTTGA.....................................................................................2011.001.00----1.00--------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTAAC....................................................................................2211.0013.00-----------------------------------------1.00-------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................GAAATACAACTCACAGCT....................1811.001.00-----------------------1.00-------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAACTAT...............................................................................2711.001.00---------1.00---------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................................................................................TACAGAAATACAACTCACAGCTACAGTGAAA...........3111.001.00-------------------------------------------------------------------------------1.00-----------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACGTT........................................................................................191.000.00----------------------------------------------1.00--------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTA......................................................................................2011.0013.00------------------------------------------------------------------------------1.00------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAC....................................................................................2311.008.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------
..................................................................................................GGATCTCCTCAGCTGCGGC.....................................................................................................................................191.000.00-------------------------------------------------------------------------1.00-----------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAAT...........................................................................................231.000.001.00------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................CCTGGGCCTAGGAGGAGGGGAACA..........................................................................................2411.001.00------------1.00------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTT......................................................................................2011.0013.00----------------------------------------------------------------1.00--------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTA......................................................................................2111.0013.00----------------------------------------------------------------------------------1.00--------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAAA...................................................................................2411.008.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACATTTGCAAGA.................................................................................2511.004.00----------------------1.00--------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................................ATAGTGGCTTATGGTTCTC..............................................................1911.001.00-------------------------------------------------------------------------------------------------------------------------------------1.00-----------
..............................................................................................................................................CCTAGGAGGAGGGGAACATTTAA.....................................................................................2311.006.00-------------------------------1.00-----------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................ACAGAAATACAACTCACACCT....................211.000.00-----------------------------------------------1.00-------------------------------------------------------------------------------------------------
...............................................................................................................................................CTAGGAGGAGGGGAACATTTGAAGT..................................................................................2511.008.00----------------------------1.00--------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................TATGGTTCTCTCCACC........................................................1620.500.50-----------0.50-------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TAGGAGGAGGGGAACAT.........................................................................................1730.330.33------------------------------------------------------------------------------------------------------------------------------------------------0.33
.................................................................................................................................................................................TTATGGTTCTCTCCAC.........................................................1640.250.250.25------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
TTAGGGTCTTCTGACTTACATTCAGTCTCTCCAGAACACCCTCACAGACATTTATGATTCTAAGTCCCACAAGATGACACAGAGACATTTGAACGTGGGGATCTCCTCAGCTGCTCTTTGGCAGTTTCCTTGGAGTCCTGGGCCTAGGAGGAGGGGAACATTTGCAACTATAGTGGCTTATGGTTCTCTCCACCTCTCAGTAGTCTTTTACAGAAATACAACTCACAGCTACAGTGAAACGGGAGAACTG
...........................................................................................................................................(((...(((.((((((((.(((..((.((....)).))..))).)))))))).))))))....................................................
...........................................................................................................................................140.........................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		mjLiverWT2()
Liver Data. (liver)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		mjLiverWT3()
Liver Data. (liver)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		mjTestesWT1()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR346414(SRX098255)
Global profiling of miRNA and the hairpin pre. (Spleen)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR042462(GSM539854)
mouse macrophages [09-002]. (bone marrow)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR042460(GSM539852)
mouse neutrophil cells replicate 2 [09-002]. (blood)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		mjTestesWT2()
Testes Data. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR206941(GSM723282)
other. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR345207(SRX097268)
source: size fractionated RNA from mouse hipp. (brain)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR038744(GSM527279)
small RNA-Seq. (brain)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR206942(GSM723283)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		GSM509280(GSM509280)
small RNA cloning by length. (testes)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR038743(GSM527278)
small RNA-Seq. (dicer brain)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR206940(GSM723281)
other. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR345205(SRX097266)
source: size fractionated RNA from mouse hipp. (brain)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		GSM509278(GSM509278)
small RNA cloning by length. (piwi testes)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR345203(SRX097264)
source: size fractionated RNA from mouse hipp. (brain)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		RuiDGCR8KO(Rui)
DGCR8-dependent microRNA biogenesis is essent. (dgcr8 skin)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR034121(GSM466731)
Mili IP_Tdrd9-/- replicate2. (mili testes)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR553603(SRX182809)
source: Spermatids. (Spermatids)		SRR095855BC1(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		mjTestesWT3()
Testes Data. (testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		RuiDGCR8WT(Rui)
DGCR8-dependent microRNA biogenesis is essent. (skin)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR206939(GSM723280)
other. (brain)		SRR073954(GSM629280)
total RNA. (blood)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR306544(GSM750587)
19-24nt. (ago2 brain)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		GSM510444(GSM510444)
brain_rep5. (brain)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR345199(SRX097260)
source: size fractionated RNA from mouse hipp. (brain)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR042457(GSM539849)
mouse mast cells [09-002]. (bone marrow)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR073955(GSM629281)
total RNA. (blood)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)
...........................................................CTAAGTCCCACAAGATGT............................................................................................................................................................................. 182.000.00------------------------------------------------2.00------------------------------------------------------------------------------------------------
....................................................................................................................................................................................TGGTTCTCTCCACCTCTCGG.................................................. 201.000.00------------------------------------------------1.00------------------------------------------------------------------------------------------------
..................CATTCAGTCTCTCCAGAA...................................................................................................................................................................................................................... 1811.001.00------------------------------------------------1.00------------------------------------------------------------------------------------------------
..................................................TTTATGATTCTAAGTCCGA..................................................................................................................................................................................... 191.000.00------------------------------------------------------------------------------------------------------1.00------------------------------------------
......................................................................................................................................................................................GTTCTCTCCACCTCTTGGC................................................. 191.000.00------------------------------------------------------------------------------------------------------------------------------------1.00------------