ID: mmu-mir-6921
GENE: Srebf1(17)
chr11:60013990-60014186-


(1)
AGO.mut 		(2)
AGO1.ip 		(6)
AGO2.ip 		(1)
AGO3.ip 		(8)
B-CELL 		(20)
BRAIN 		(5)
CELL-LINE 		(2)
DCR.mut 		(1)
DGCR8.mut 		(11)
EMBRYO 		(6)
ESC 		(2)
FIBROBLAST 		(4)
HEART 		(2)
KIDNEY 		(17)
LIVER 		(2)
LUNG 		(5)
LYMPH 		(13)
OTHER 		(8)
OTHER.mut 		(1)
OVARY 		(2)
PANCREAS 		(4)
SKIN 		(6)
SPLEEN 		(19)
TESTES 		(1)
THYMUS 		(2)
TOTAL-RNA 		(3)
UTERUS

Sense strand
TGAGCAGCCTGCGGCGGTTGGCACAGAGCTTCCGGCCTGCTATGAGGAGGGTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTCTCAGGTATTCCTACATGAGGCCACAGCTCGGCTGATGGCAGGAGCAAGTCCTGC
.......................................................................((((((((((...(((.....))).(((((((...........(((((...)))))..))))))).))))))))))..................................................
...................................................................68.............................................................................147................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjLiverWT1()
Liver Data. (liver)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206942(GSM723283)
other. (brain)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR346415(SRX098256)
source: Testis. (Testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT3()
Liver Data. (liver)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR065059(SRR065059)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR206941(GSM723282)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR206940(GSM723281)
other. (brain)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		mjTestesWT2()
Testes Data. (testes)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR060845(GSM561991)
total RNA. (brain)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042476(GSM539868)
mouse heart tissue [09-002]. (heart)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR553582(SRX182788)
source: Brain. (Brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)
..............................................................................................................................TGACTACTCCTTGCCTCTCAGT.................................................221184.0012.0028.0017.0012.0011.00-3.0014.00-6.006.004.004.003.004.00--5.00-1.003.00--3.00--4.001.003.001.002.004.001.002.00---3.002.001.002.00-1.00---1.00---1.00-2.001.00----1.00-1.00---1.00-1.001.00-2.001.001.001.001.00------1.00-1.00------1.001.00---1.00----1.001.001.00---1.00-1.001.00-----1.00-1.00-1.001.00--------1.00-1.00---
..............................................................................................................................TGACTACTCCTTGCCTCTCAGA.................................................22132.0012.00--2.001.00-2.003.00-1.001.001.001.001.001.00--1.003.001.00---1.00-1.00--1.00-1.00-1.00-------1.00-----1.00---------2.00-------------1.00--------------1.00-----------------1.00----------------1.00-------------
........................................................................TGAGGGGCATGAGGTAGGAAGC.......................................................................................................22123.0023.00----3.00---1.00-----1.00-----------------1.001.00----1.00--1.002.001.00--1.001.00------1.00-------1.00-----------1.00--1.00-----1.00----------1.00-1.00----1.00-------------------1.00-----------
........................................................................TGAGGGGCATGAGGTAGGAAG........................................................................................................21119.0019.00----2.002.00--1.00--1.00--------------2.00-------------2.001.00-1.00------------1.00---------1.001.00-----------------------1.00------------------1.00-----------1.00--------1.00-
.......................................................................CTGAGGGGCATGAGGTAGGAAG........................................................................................................22115.0015.00----7.001.00--------1.00-------------1.00-----------------1.00------1.00------1.00--------------------------------------------------1.00------------1.00--------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGC.................................................22112.0012.00--2.003.00----3.002.00----------------------------1.00----------------------------------------------------------1.00-----------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAG..................................................21112.0012.00---1.00-----2.00--1.00-2.00---1.00--1.00------------------------------1.00------------------------------------------1.00------------1.00-----------1.00------------
..................................................GTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTC......................................................9318.008.00-------8.00-----------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................ACATGAGGCCACAGCTCGGCT.....................2117.007.00-------------------2.00---4.00--------1.00----------------------------------------------------------------------------------------------------
.........................................................................................................................ACGGGTGACTACTCCTTGCCTCTCAG..................................................2616.006.00---------------6.00---------------------------------------------------------------------------------------------------------------------
............................................................................................................................GGTGACTACTCCTTGCCTCTC....................................................2115.005.00--------------------5.00----------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCACT.................................................2215.005.00-3.00-------1.00-------------------------------------------------1.00-------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCA...................................................2015.005.00-2.002.00----------------------------------------------1.00-----------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGA..........................................................................................................1914.004.00----3.00-----------------------------------1.00--------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAA.........................................................................................................2014.004.00---1.00-----1.00------------1.00-------------------------------------1.00------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCATT.................................................2214.005.00-----1.00------------3.00------------------------------------------------------------------------------------------------------------------
......................................................................ACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTCTCAG..................................................7713.003.00-------3.00-----------------------------------------------------------------------------------------------------------------------------
.................................GGCCTGCTATGAGGAGG...................................................................................................................................................1713.003.00-------------3.00-----------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGTA................................................2313.0012.00----------1.00-2.00------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAT..................................................2113.005.00--------------1.00-----------1.00------------------------------------1.00---------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGT.......................................................................................................2213.0019.00----1.001.00-----1.00-------------------------------------------------------------------------------------------------------------------------
................................CGGCCTGCTATGAGGAGG...................................................................................................................................................1813.003.00--------------------------1.00-------------------------------1.00--------------------------------------------1.00-----------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGA.......................................................................................................2213.0019.00-----1.00--1.00-----------------------------------1.00----------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGAA......................................................................................................2313.0019.00---------------------1.00----------------------------1.00-----1.00----------------------------------------------------------------------------
.............................................................................................................................GTGACTACTCCTTGCCTCTCAGA.................................................232.000.00------------------------------------------------2.00------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCT......................................................................................................2312.0023.00-----------------------------------2.00-------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCT.....................................................1812.002.00--------------2.00----------------------------------------------------------------------------------------------------------------------
......................................................................ACTGAGGGGCATGAGGTAGGA..........................................................................................................2112.002.00--1.00-----------------------------------------------------------------------------------1.00----------------------------------------------
......................................................................ACTGAGGGGCATGAGGTA.............................................................................................................1812.002.00-----1.00----------------------------1.00--------------------------------------------------------------------------------------------------
.........................................................CCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTCTCAG..................................................9012.002.00-------2.00-----------------------------------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCA......................................................................................................2312.0023.00-----------------------------------------------1.00--------------------------------1.00----------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAT........................................................................................................2112.004.00--------------1.00----------------------------------------------------------------------1.00-----------------------------------------------
.......................CAGAGCTTCCGGCCTGCTATGAGGAGG...................................................................................................................................................2712.002.00------------------------1.00-------------------------1.00----------------------------------------------------------------------------------
...................GGCACAGAGCTTCCGGCCTGCT............................................................................................................................................................2212.002.00-------------------------1.00-----1.00-----------------------------------------------------------------------------------------------------
......................ACAGAGCTTCCGGCCTGCTATGAGG......................................................................................................................................................2512.002.00-----1.00----------------------------------------------------------------------------------------------------------1.00--------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAAT.................................................2212.005.00----2.00--------------------------------------------------------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAG............................................................................................................1822.002.00---------------------------------0.501.50--------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCC......................................................................................................2312.002.00---------------------2.00---------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTC....................................................1911.001.00---------------------1.00---------------------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCAT.....................................................................................................2411.0023.00----------1.00--------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................GACTACTCCTTGCCTCTCAGT.................................................211.000.00-------------------------------------------------------------------1.00-----------------------------------------------------------------
..................................................GTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTCT.....................................................9411.001.00-------1.00-----------------------------------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGCAG........................................................................................................211.000.00------------------------------------------------------------------------------------------------------------------------------1.00------
.......................................................................CTGAGGGGCATGAGGTAGG...........................................................................................................1911.001.00------------1.00------------------------------------------------------------------------------------------------------------------------
...........CGGCGGTTGGCACAGAGCTTCCGGC.................................................................................................................................................................2511.001.00-------------------------------------------------------------1.00-----------------------------------------------------------------------
.............................TTCCGGCCTGCTATGAGGAGGGTATT..............................................................................................................................................261.000.00------------------------1.00------------------------------------------------------------------------------------------------------------
............................................................................................................................GGTGACTACTCCTTGCCTCTCT...................................................2211.005.00-------------------------------------------1.00-----------------------------------------------------------------------------------------
......................ACAGAGCTTCCGGCCTGCTATGAGGAG....................................................................................................................................................2711.001.00----------------------------------------------------------1.00--------------------------------------------------------------------------
..............................................................................................................................................................TGAGGCCACAGCTCGGCAA....................191.000.00---------------------------------------------1.00---------------------------------------------------------------------------------------
..................................GCCTGCTATGAGGAGGGTA................................................................................................................................................191.000.00-----------------------------1.00-------------------------------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGAA.........................................................................................................2111.001.00-----------------------------------------------------------------------------------------------------------------------------1.00-------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGTAA...............................................2411.0012.00-------------------------------------1.00-----------------------------------------------------------------------------------------------
....................GCACAGAGCTTCCGGCCTGCTATGAGGAGG...................................................................................................................................................3011.001.00----------------------------------------------------------------1.00--------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCTT.....................................................................................................2411.0023.00-----------------------------------------------1.00-------------------------------------------------------------------------------------
..........................................................................................................................................................TACATGAGGCCACAGCTCGGCTGATGGCAA.............301.000.00----------------------------------------------------------------1.00--------------------------------------------------------------------
.............................................................................................................................................................ATGAGGCCACAGCTCGGCTTATT.................2311.001.00---------------1.00---------------------------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCAAAA...................................................................................................2611.0023.00----------------------------------------------------------------------------------1.00--------------------------------------------------
..................................................GTGAGTCCCACTGTTCTCACACTGAGGGG......................................................................................................................2911.001.00------------------------------------------------------------------------------------------1.00------------------------------------------
.....................CACAGAGCTTCCGGCCTGCT............................................................................................................................................................2011.001.00-----1.00-------------------------------------------------------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGAAGTAT.....................................................................................................2511.0015.00--------------------------------------------------------------------------------------------------------------------1.00----------------
........................................................................TGAGGGGCATGAGGTAGGAAGCTAG....................................................................................................2511.0023.00----------------------------------------------------------------------------1.00--------------------------------------------------------
.........................GAGCTTCCGGCCTGCTATGA........................................................................................................................................................2011.001.00---------------------------------------------------------------------------1.00---------------------------------------------------------
.............................................................................................................................................................ATGAGGCCACAGCTCGGCT.....................1911.001.00---------------------------------------------------------------------------------------1.00---------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGA..........................................................................................................2011.001.00----------------------------1.00--------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCACC.................................................2211.005.00--------------------------------------------------------------------------------------------------------------------------------1.00----
..................................................GTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGA.......................................................................761.000.00-------1.00-----------------------------------------------------------------------------------------------------------------------------
........................................................................................................GGGACAGTAAATCTGAAACGGG.......................................................................2211.001.00-------------------------------------------------------------1.00-----------------------------------------------------------------------
.......................................................................................................................................................................AGCTCGGCTGATGGCAT.............171.000.00------------------------1.00------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................ATGAGGCCACAGCTCGGCTGATT.................231.000.00---------------1.00---------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGTT................................................2311.0012.00---------------------------------------------------------------------------------------------------------------------------1.00---------
........................................................................TGAGGGGCATGAGGTAGGAAGAC......................................................................................................2311.0019.00----------1.00--------------------------------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCTA.....................................................................................................2411.0023.00----------------------------------------------1.00--------------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGAAAAA......................................................................................................2411.001.00---------------------------------1.00---------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGTTT.....................................................................................................2411.0019.00-----1.00-------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................GGTGACTACTCCTTGCCTCTCA...................................................2211.001.00----------------------------------------------------------------------------------------------------------------------------------1.00--
..............................................................................................................................................................TGAGGCCACAGCTCGGCTGATGGCAT.............261.000.00------------------------1.00------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTTA...................................................2011.002.00----------1.00--------------------------------------------------------------------------------------------------------------------------
......................ACAGAGCTTCCGGCCTGCTATGAAA......................................................................................................................................................251.000.00-----------1.00-------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGAAGA..............................................2511.0012.00-----------------------------------------------------------------1.00-------------------------------------------------------------------
..........................................................................AGGGGCATGAGGTAGGAAGCCGT....................................................................................................231.000.00----------------------------1.00--------------------------------------------------------------------------------------------------------
................................................................................................................................ACTACTCCTTGCCTCTCAG..................................................1911.001.00-------------------------------1.00-----------------------------------------------------------------------------------------------------
.....................................................................................................................................................................ACAGCTCGGCTGATGGCAGG............2011.001.00--1.00----------------------------------------------------------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGAAGC.......................................................................................................2311.001.00---------------------------------1.00---------------------------------------------------------------------------------------------------
.....................CACAGAGCTTCCGGCCTGCTATGAGGA.....................................................................................................................................................2711.001.00------------------------------------------------------------------------------------------------------------------1.00------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCT...................................................2011.001.00---1.00---------------------------------------------------------------------------------------------------------------------------------
..................................GCCTGCTATGAGGAGG...................................................................................................................................................1611.001.00------------------------------------------------1.00------------------------------------------------------------------------------------
..........................................................................AGGGGCATGAGGTAGGAAGCCGTCT..................................................................................................251.000.00-----------------------------------------------------1.00-------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCCT.....................................................................................................2411.002.00--------------------------------------------1.00----------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAGCCAGT...................................................................................................2611.002.00----------------------------------1.00--------------------------------------------------------------------------------------------------
.........................................ATGAGGAGGGTGAGTCCCACT.......................................................................................................................................2111.001.00-----------------------1.00-------------------------------------------------------------------------------------------------------------
.................................GGCCTGCTATGAGGAGGGT.................................................................................................................................................1911.001.00--------------------------------------------------------------1.00----------------------------------------------------------------------
.......................................................................................................................................................................AGCTCGGCTGATGGCAGG............1811.001.00-----------1.00-------------------------------------------------------------------------------------------------------------------------
......................ACAGAGCTTCCGGCCTGCTATGAG.......................................................................................................................................................2411.001.00------------------------------------------1.00------------------------------------------------------------------------------------------
..............................................................................................CGGGAGTGGGGGGACGGT.....................................................................................181.000.00-------------------------------------------------------------------------1.00-----------------------------------------------------------
......................................................................ACTGAGGGGCATGAGGTAGGAT.........................................................................................................2211.002.00------------------------------------------------------------------------------1.00------------------------------------------------------
...............................................................................................................................GACTACTCCTTGCCTCTCATT.................................................2111.001.00--------------------------------------------------------------------------------------------1.00----------------------------------------
........................................................................TGAGGGGCATGAGGTAGGT..........................................................................................................191.000.00-----------------------------------1.00-------------------------------------------------------------------------------------------------
........................................................................TGAGGGGCATGAGGTAGGAAAAA......................................................................................................2311.004.00-----1.00-------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................CTACTCCTTGCCTCTCAGACC...............................................211.000.00--1.00----------------------------------------------------------------------------------------------------------------------------------
......................................................................ACTGAGGGGCATGAGGTAGGAA.........................................................................................................2211.001.00------------------------------------------------------1.00------------------------------------------------------------------------------
.......................................................................CTGAGGGGCATGAGGTAGGAAGCT......................................................................................................2411.001.00-------------------------------------------------------------------------------------------------------------1.00-----------------------
...............................................................................................................................GACTACTCCTTGCCTCTCA...................................................1911.001.00-----1.00-------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAC..................................................2111.005.00---------------------------------------------------------1.00---------------------------------------------------------------------------
..................................................GTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTA......................................................931.000.00-------1.00-----------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................TGACTACTCCTTGCCTCTCAGTAT...............................................2411.0012.00--------------------------------------------1.00----------------------------------------------------------------------------------------
......................................................................ACTGAGGGGCATGAGG...............................................................................................................1630.330.33-----------------------------------0.33-------------------------------------------------------------------------------------------------

Antisense strand
TGAGCAGCCTGCGGCGGTTGGCACAGAGCTTCCGGCCTGCTATGAGGAGGGTGAGTCCCACTGTTCTCACACTGAGGGGCATGAGGTAGGAAGCCGGGAGTGGGGGGACAGTAAATCTGAAACGGGTGACTACTCCTTGCCTCTCAGGTATTCCTACATGAGGCCACAGCTCGGCTGATGGCAGGAGCAAGTCCTGC
.......................................................................((((((((((...(((.....))).(((((((...........(((((...)))))..))))))).))))))))))..................................................
...................................................................68.............................................................................147................................................
SizePerfect hitTotal NormPerfect NormmjLiverWT2()
Liver Data. (liver)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346418(SRX098259)
Global profiling of miRNA and the hairpin pre. (Liver)		mjLiverWT1()
Liver Data. (liver)		SRR346421(SRX098263)
Global profiling of miRNA and the hairpin pre. (mixture)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR206942(GSM723283)
other. (brain)		GSM640579(GSM640579)
small RNA in the liver with paternal Low pro. (liver)		SRR346415(SRX098256)
source: Testis. (Testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR685339(GSM1079783)
"Small RNAs (15-50 nts in length) from immort. (cell line)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR685340(GSM1079784)
"Small RNAs (15-50 nts in length) from immort. (dicer cell line)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		mjTestesWT3()
Testes Data. (testes)		mjLiverWT3()
Liver Data. (liver)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR065059(SRR065059)
Tissue-specific Regulation of Mouse MicroRNA . (pancreas)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR206941(GSM723282)
other. (brain)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR346413(SRX098254)
Global profiling of miRNA and the hairpin pre. (Heart)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR206940(GSM723281)
other. (brain)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR394084(GSM855970)
"background strain: C57BL6/SV129cell type: KR. (dicer cell line)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		SRR065052(SRR065052)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR346416(SRX098257)
Global profiling of miRNA and the hairpin pre. (Kidney)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR042479(GSM539871)
mouse liver tissue [09-002]. (liver)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR042468(GSM539860)
mouse Th1 cells [09-002]. (lymph)		SRR346420(SRX098261)
Global profiling of miRNA and the hairpin pre. (Uterus)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		GSM640581(GSM640581)
small RNA in the liver with paternal control. (liver)		SRR014231(GSM319955)
16.5 dpc total. (testes)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR077864(GSM637801)
18-30 nt small RNAs. (liver)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR037905(GSM510441)
brain_rep2. (brain)		SRR345196(SRX097257)
source: size fractionated RNA from mouse hipp. (brain)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042478(GSM539870)
mouse lung tissue [09-002]. (lung)		SRR095855BC3(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR065047(SRR065047)
Tissue-specific Regulation of Mouse MicroRNA . (liver)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR037922(GSM510460)
e12p5_rep4. (embryo)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR206939(GSM723280)
other. (brain)		SRR037907(GSM510443)
brain_rep4. (brain)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		mjTestesWT2()
Testes Data. (testes)		SRR077865(GSM637802)
18-30 nt small RNAs. (liver)		SRR060845(GSM561991)
total RNA. (brain)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042486(GSM539878)
mouse ovaries [09-002]. (ovary)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR037923(GSM510461)
e9p5_rep1. (embryo)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042481(GSM539873)
mouse pancreatic tissue [09-002]. (pancreas)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		GSM640578(GSM640578)
small RNA in the liver with paternal control. (liver)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR039152(GSM471929)
HL1_siNon_smallRNAseq. (muscle)		SRR042476(GSM539868)
mouse heart tissue [09-002]. (heart)		SRR073955(GSM629281)
total RNA. (blood)		SRR553585(SRX182791)
source: Kidney. (Kidney)		SRR553582(SRX182788)
source: Brain. (Brain)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR345200(SRX097261)
source: size fractionated RNA from mouse hipp. (brain)
....................................................................................................................................CTCCTTGCCTCTCAGGTATTCCTACA....................................... 2613.003.00-----------------3.00-------------------------------------------------------------------------------------------------------------------
......................................................GTCCCACTGTTCTCAGCTC............................................................................................................................ 191.000.00---------------------------------------------------------------------------------------------------------1.00---------------------------
..............................TCCGGCCTGCTAT.......................................................................................................................................................... 1390.110.11------------------------------------------------------------------------------------------------------------------------------------0.11