ID: mmu-mir-6904
GENE: Parp1(7)
chr1:182517192-182517441+


(1)
AGO.mut 		(3)
AGO1.ip 		(9)
AGO2.ip 		(2)
AGO3.ip 		(12)
B-CELL 		(13)
BRAIN 		(5)
CELL-LINE 		(2)
DGCR8.mut 		(9)
EMBRYO 		(13)
ESC 		(3)
FIBROBLAST 		(1)
HEART 		(7)
LIVER 		(1)
LUNG 		(1)
LYMPH 		(17)
OTHER 		(6)
OTHER.mut 		(3)
PIWI.ip 		(6)
SKIN 		(6)
SPLEEN 		(18)
TESTES 		(3)
THYMUS 		(3)
TOTAL-RNA

Sense strand
TGCCCTCTGTTTCCCCGCTGCCTGTTGGCGCCTGTCTTCATAAAGTTTTCCCAAAGAAAAGAGTGAAGACCAAGGCTGGCCAGGCTCTGTGGCTTCTATGGTTTCTCCTAAAGCCAGCTGTTTTGTCTTGCCTCCATTCATCCTTTCCTGGGGTTAGAGTTGAGTGGTCGTAGCCTGTTGCTTCTGATCTCTTACCCCAGACAAGCCCCTGTCTAACATGAAGATCCTGACTCTTGGGAAGCTCTCCCAG
..............................................................................................................................................(((..(((((((.((((.....(((..((((....))))..)))..)))).)))))))..))).............................................
............................................................................................................................................141...............................................................207.........................................
SizePerfect hitTotal NormPerfect NormSRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverWT3()
Liver Data. (liver)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR073954(GSM629280)
total RNA. (blood)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR206941(GSM723282)
other. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR023849(GSM307158)
NPCsmallrna_rep1. (cell line)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR014229(GSM319953)
10 dpp MILI. (mili testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		mjTestesWT2()
Testes Data. (testes)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGG...................................................................................22163.0063.002.001.004.002.001.004.004.00--2.00-2.00----1.005.002.001.002.001.00--1.00-1.001.00--1.002.00-1.00---1.001.00------2.001.001.001.00-1.00--1.001.001.001.00------1.00---1.00-1.001.00----1.00-1.00---1.00---------1.00-------------1.00--------1.00---
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGG...................................................................................23128.0028.001.00-2.00-1.00-1.001.001.00---1.003.001.001.001.00-1.00----2.001.00--------2.00-----1.00------------2.001.00---1.00------1.001.00-----------------------------------------------1.00----
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAG...............................................21114.006.00-4.00--1.00-----5.001.00---2.00------------------------------------------1.00-----------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAA...............................................21114.006.00--------3.00------2.00-----1.00-------3.00----------1.00--1.00----------------1.00---------------1.00---------------------------------1.00-------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGT..................................................................................23114.0014.00-2.001.00--1.003.001.00--------1.00------1.00--------------------1.00---------1.00---------------------------------------1.00--------------1.00--------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTGG...................................................................................2417.007.00----1.00----1.00----1.00------1.00---------------------------------------------------------1.00--------------------------------1.00----1.00
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGT.....................................................................................2217.007.00-1.00-------1.00---------------4.00--------------------1.00-----------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGA..................................................................................2317.0063.00-------------------1.00---------------1.001.00-------------------1.00---------------1.00---------------1.00---1.00-------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGA.................................................1916.006.00--------2.001.00-1.001.001.00--------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGA...................................................................................2215.003.00-----1.00---1.00-----------------------------1.00-----------------1.00----1.00-------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGG...................................................................................2115.005.001.00-1.00-----------2.00------------------------------------1.00------------------------------------------------------------------
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGAAGCT.......2415.005.003.00---2.00-----------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGA...............................................2115.006.00--1.003.00-------1.00----------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCT................2014.004.00--1.00-----------------------2.00----------------------------------------------------------------------------1.00--------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGT..................................................................................2414.004.00----------------1.00----1.00------------------------------------------------------------------------------------1.00--------1.00--
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGT.....................................................................................2114.004.00---------------------------2.00-------------------1.00------------1.00---------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGAGA...............................................2214.001.002.00-1.00-----------------------------------1.00-------------------------------------------------------------------------------
...........................................................................................................................................ATCCTTTCCTGGGGTTAGAGTTGAG......................................................................................2514.004.00---3.00----------------------------------------------------------------------------------1.00-------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAAAAA...............................................214.000.00---4.00------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGT.....................................................................................2014.004.00-------------------1.00---1.00---1.00------------------------------------------------------1.00-----------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGTTT...............................................2113.001.00------------1.00----------------------------------------------2.00----------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGACTCT................2213.003.00--1.00----1.00----------------------1.00---------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGACA...............................................2113.003.00----------------------1.00------------------------------------------------------------1.00-----------1.00----------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGA..............................................2213.006.00----1.00---------------------1.00-------------------------------------------------------------------------1.00-----------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAG......................................................................................2113.003.00--------------------------------1.00--------2.00----------------------------------------------------------------------------
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGA...........2013.003.00--1.00-1.00--1.00--------------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTG....................................................................................2113.003.00-------------------------------------------------------1.00-------------------------------1.00-----------1.00------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGAAA.............................................2313.006.00----------3.00-----------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTC.................1913.003.00----------------------------1.00-1.00-----1.00---------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAAA..............................................2213.006.00----1.00---1.00-------1.00-----------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAATT..............................................2212.006.00------------1.00-----------1.00---------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAT...............................................2112.006.00-1.00---------------------------------------------------------------------------------------1.00----------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGT...................................................................................2312.002.00--------------------1.00---1.00---------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGA...................................................................................2312.002.00----1.00--------------------------------1.00--------------------------------------------------------------------------------
.......................................................................................................................................................................................................................ACATGAAGATCCTGACT..................1712.002.00----------------------2.00-----------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGT...................................................................................2212.003.00-----1.00-------------1.00--------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAAAA................................................202.000.00----------------------------------2.00-----------------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGAAA...............................................2212.001.00-------1.00------------------------------------------------------------------------1.00-------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGGT..................................................................................2212.002.00-2.00--------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTT...............2112.002.001.00---1.00-----------------------------------------------------------------------------------------------------------------
................................................................................................................................................................................................................CTGTCTAACATGAAGATCC.......................1912.002.00------1.00------------------------------------------------------------------------------------------1.00--------------------
...........................................................................................................................................................................................................................GAAGATCCTGACTCTTGGGAAG.........2212.002.00-------1.00----------------------------------1.00---------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGCGT.....................................................................................202.000.00-----------------------------------1.00------------------------------------------------1.00---------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTG....................................................................................2212.002.00----------------------------------1.00-----1.00-----------------------------------------------------------------------------
.......................................................................................................................................................................................................................ACATGAAGATCCTGACTCT................1912.002.002.00---------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................CTGGGGTTAGAGTTGAGGGG...................................................................................201.000.00------------------1.00---------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................................GTCTAACATGAAGATCC.......................1711.001.00----------------------1.00-----------------------------------------------------------------------------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTGGA..................................................................................2511.007.001.00---------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................................AGATCCTGACTCTTGGGA...........1811.001.001.00---------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGT...................................................................................211.000.00-----1.00----------------------------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGTTT................................................................................2611.004.00---------------------------------------------------------------------------------------------1.00------------------------
...................................................................................................................................................CTGGGGTTAGAGTTGAGTGG...................................................................................2011.001.00------------------1.00---------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGC..............................................2211.006.001.00---------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAAAA.............................................2311.006.00-------------------------------------------------------------------------------------1.00--------------------------------
..............................................................................................................................................CTTTCCTGGGGTTAGAGTTGAG......................................................................................2211.001.00-1.00--------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................CCCCTGTCTAACATGAAGATCCTG.....................2411.001.00------------------------------------------------------------------------------------------------------------1.00---------
.............................................................................................................................................CCTTTCCTGGGGTTAGAGTTGAG......................................................................................2311.001.00-1.00--------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................TAACATGAAGATCCTGACTCTTGGGAAGCTC......3111.001.00--------------------------------------------------------------------------------------------------------1.00-------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGATAGA.............................................2311.006.00-------1.00--------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCAGA.................................................2011.001.00-1.00--------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAAGT..............................................2211.006.00------1.00---------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................AGTGGTCGTAGCCTGTATGG....................................................................201.000.00------------------------------------------------------------------------------------------------------1.00---------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGCAGT..............................................2211.001.00-----1.00----------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGCTGT.................211.000.001.00---------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................TAACATGAAGATCCTGACTCTT...............2211.001.00--------------------1.00-------------------------------------------------------------------------------------------------
.........................................................................................................................................................................................................................ATGAAGATCCTGACTCTTGGGAAGC........2511.001.00--------------------------------------------------1.00-------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACT..................1811.001.00----------------------------1.00-----------------------------------------------------------------------------------------
...................................................................................................................................................................................................................TCTAACATGAAGATCCTGACTCTTGGGAAGC........3111.001.00-------------------------------1.00--------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTA....................................................................................2211.004.00--------------------------------------------1.00-------------------------------------------------------------------------
..........................................................................................................................................................................................................................TGAAGATCCTGACTCTTGGGAAGCTC......2611.001.00-------------------------------------------------1.00--------------------------------------------------------------------
....................................................................................................................................................................................................................CTAACATGAAGATCCTGA....................1811.001.00------------------------------------------------1.00---------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGTT..................................................................................2311.003.00-----1.00----------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGATTT..............................................2211.006.00------------1.00---------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGTGGAT.................................................................................2411.0063.00-----------1.00----------------------------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAG......................................................................................1911.001.001.00---------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGGAA.................................................................................2311.005.00-------------------------------------------1.00--------------------------------------------------------------------------
..................................................................................................................................................................AGTGGTCGTAGCCTGCAT......................................................................181.000.00--------------------------------------------------------------------------1.00-------------------------------------------
...........................................................AGAGTGAAGACCAAGGCTGG...........................................................................................................................................................................2011.001.00--------------------------------------------------------------------------------------------------------------------1.00-
......................................................................................................................................................................................................AGACAAGCCCCTGTCTAAC.................................1911.001.00-------1.00--------------------------------------------------------------------------------------------------------------
.........................................AAAGTTTTCCCAAAGAAAAGA............................................................................................................................................................................................2111.001.001.00---------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTTG..............2211.001.00-----------------------------------------------------------------------1.00----------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGA.......................................................................................1811.001.00-------------1.00--------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAGT...............................................2111.006.00------------1.00---------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................CCTGTTGCTTCTGATCTCTTACCCCAG..................................................2711.001.00---------1.00------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AACATGAAGATCCTGACTCTTGGGAAGCTC......3011.001.00------------------------------------------------------------------------------1.00---------------------------------------
.............................................................................................................................................CCTTTCCTGGGGTTAGAGTTGAGT.....................................................................................2411.001.00------------------------------------------------------------------------------------------1.00---------------------------
...............................................................................................................................................TTTCCTGGGGTTAGAGTTGAGTAT...................................................................................2411.007.00--------------------------------1.00-------------------------------------------------------------------------------------
.................................................................................................................................................TCCTGGGGTTAGAGTTGAGGGT...................................................................................2211.001.00-------------------------------------------------------------------------1.00--------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAG......................................................................................2011.001.00---------------------------------------------------1.00------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGC...................................................................................2311.002.00------------------------------------------------------------------------------------------------1.00---------------------
..........................................................................................................................................................................................................................TGAAGATCCTGACTCTTGGGAAGCTCA.....2711.001.00-------------------------------------------------1.00--------------------------------------------------------------------
.......................................................................................................................................................................TCGTAGCCTGTTGCTTCTGATCTCTTACCCCAG..................................................3311.001.00------------------------------------------------------------------1.00---------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAG..................................................1811.001.00--------------------------------------------------------------------1.00-------------------------------------------------
.............................................................................................................................................................AGTTGAGTGGTCGTAGCCTGTTG......................................................................2311.001.00--------1.00-------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGAA................................................2011.006.00---------1.00------------------------------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGTGGTAT................................................................................2611.004.00--------------------------------1.00-------------------------------------------------------------------------------------
................................................................................................................................................TTCCTGGGGTTAGAGTTGAGCGG...................................................................................2311.001.00---------------------------------------------------------------------------------------------------------------1.00------
..................................................................................................................................................CCTGGGGTTAGAGTTGAG......................................................................................1811.001.00----------------------------------------------------------1.00-----------------------------------------------------------
......................................................................................................................................................................................TCTGATCTCTTACCCCAGACT...............................................211.000.00--------------1.00-------------------------------------------------------------------------------------------------------
..................................................................................................................................................CCTGGGGTTAGAGTTGAGTGA...................................................................................211.000.00-----------------------------------------------------------------------------------------------------1.00----------------
........................................................................................................................................................................................................................CATGAAGATCCTGACCGT................181.000.00----------------------------1.00-----------------------------------------------------------------------------------------
........................................................................................................................................................................................................................CATGAAGATCCTGACTCTTG..............2011.001.00------------------------------------------1.00---------------------------------------------------------------------------
.....................................................................................................................................................................................TTCTGATCTCTTACCCCA...................................................1811.001.00-------------1.00--------------------------------------------------------------------------------------------------------

Antisense strand
TGCCCTCTGTTTCCCCGCTGCCTGTTGGCGCCTGTCTTCATAAAGTTTTCCCAAAGAAAAGAGTGAAGACCAAGGCTGGCCAGGCTCTGTGGCTTCTATGGTTTCTCCTAAAGCCAGCTGTTTTGTCTTGCCTCCATTCATCCTTTCCTGGGGTTAGAGTTGAGTGGTCGTAGCCTGTTGCTTCTGATCTCTTACCCCAGACAAGCCCCTGTCTAACATGAAGATCCTGACTCTTGGGAAGCTCTCCCAG
..............................................................................................................................................(((..(((((((.((((.....(((..((((....))))..)))..)))).)))))))..))).............................................
............................................................................................................................................141...............................................................207.........................................
SizePerfect hitTotal NormPerfect NormSRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR546155(SRX180174)
Global profiling of miRNA and the hairpin pre. (ago2 Neuroblastoma)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR346424(SRX098266)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		mjLiverKO1()
Liver Data. (Zcchc11 liver)		SRR346425(SRX098267)
Global profiling of miRNA and the hairpin pre. (Neuroblastoma)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314557(GSM314557)
ESC dgcr8 (Illumina). (ESC)		SRR553602(SRX182808)
source: Sertoli cells. (Sertoli cells)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		mjLiverWT3()
Liver Data. (liver)		mjLiverKO3()
Liver Data. (Zcchc11 liver)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		Ago2IP504(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR345202(SRX097263)
source: size fractionated RNA from mouse hipp. (brain)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR037914(GSM510451)
newborn_rep7. (total RNA)		SRR073954(GSM629280)
total RNA. (blood)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR042444(GSM539836)
mouse pre B cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR525243(SRA056111/SRX170319)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR206941(GSM723282)
other. (brain)		SRR553582(SRX182788)
source: Brain. (Brain)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR059765(GSM562827)
DN3_control. (thymus)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR346419(SRX098260)
Global profiling of miRNA and the hairpin pre. (Lung)		SRR023849(GSM307158)
NPCsmallrna_rep1. (cell line)		SRR553583(SRX182789)
source: Cerebellum. (Cerebellum)		SRR345204(SRX097265)
source: size fractionated RNA from mouse hipp. (brain)		SRR525244(SRA056111/SRX170320)
Mus musculus domesticus miRNA sequencing. (ago2 Blood)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR065054(SRR065054)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		GSM314553(GSM314553)
ESC dcr (Illumina). (ESC)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR345198(SRX097259)
source: size fractionated RNA from mouse hipp. (brain)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR346417(SRX098258)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR014229(GSM319953)
10 dpp MILI. (mili testes)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		GSM314559(GSM314559)
ESC dgcr8 (454). (ESC)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (epididymis)		SRR065055(SRR065055)
Tissue-specific Regulation of Mouse MicroRNA . (jejunum)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR038745(GSM527280)
small RNA-Seq. (dgcr8 brain)		SRR029123(GSM416611)
NIH3T3. (cell line)		GSM640580(GSM640580)
small RNA in the liver with paternal Low pro. (liver)		SRR553604(SRX182810)
source: Spermatocytes. (Spermatocytes)		SRR014232(GSM319956)
16.5 dpc MILI. (mili testes)		SRR525241(SRA056111/SRX170317)
Mus musculus domesticus miRNA sequencing. (ago1 Blood)		SRR346423(SRX098265)
Global profiling of miRNA and the hairpin pre. (Brain)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039154(GSM471931)
HL1_siSrf2_smallRNAseq. (muscle)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR553584(SRX182790)
source: Heart. (Heart)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR306528(GSM750571)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR553586(SRX182792)
source: Testis. (testes)		SRR042446(GSM539838)
mouse mature B cells (spleen) replicate 1 [09-002]. (b cell)		SRR014231(GSM319955)
16.5 dpc total. (testes)		SRR345201(SRX097262)
source: size fractionated RNA from mouse hipp. (brain)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (ago2 liver)		mjTestesWT2()
Testes Data. (testes)		SRR346415(SRX098256)
source: Testis. (Testes)		SRR346422(SRX098264)
Global profiling of miRNA and the hairpin pre. (Muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR306531(GSM750574)
19-24nt. (ago2 brain)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		GSM509279(GSM509279)
MVH-/- E16.5 small RNA. (testes)		SRR065050(SRR065050)
Tissue-specific Regulation of Mouse MicroRNA . (liver)
...........TCCCCGCTGCCTGTTCTT............................................................................................................................................................................................................................. 181.000.00-------------------------------------------------------------1.00--------------------------------------------------------
....................................................................................................GTTTCTCCTAAAGCCAGC.................................................................................................................................... 1811.001.00-------------------------------------------------------------1.00--------------------------------------------------------
....................................................................................................................................................................................CTTCTGATCTCTTACCCGA................................................... 191.000.00--------------------------------------------------------------------------------------------------1.00-------------------
........................................................................................................................................................................................................ACAAGCCCCTGTCTAATT................................ 181.000.00-----------------------------------------------------------------------------------------------------------1.00----------