ID: mmu-mir-669p-2
chr2:10418074-10418260 +
Display Libraries
(1)
AGO1.ip 		(7)
AGO2.ip 		(9)
B-CELL 		(13)
BRAIN 		(7)
CELL-LINE 		(1)
DGCR8.mut 		(12)
EMBRYO 		(12)
ESC 		(9)
FIBROBLAST 		(2)
LIVER 		(4)
LYMPH 		(9)
OTHER 		(10)
OTHER.mut 		(3)
PIWI.ip 		(1)
PIWI.mut 		(1)
SKIN 		(8)
SPLEEN 		(26)
TESTES 		(4)
THYMUS 		(1)
TOTAL-RNA 		(2)
UTERUS
Showing top 69 reads
AAATTCATACTTATCCTCATGAGAGATCAGCCTGTGATTCCTCCATGTATGTGCATGTGTGTATAGTTGTGTGTGCATGTTCATGTCTATATTTGAATATACATAACATACACACACACACGTATAAACGCAAGCACACATACACAGACACAGGAATGGCATTCGCCAATCCCTTTGAATGATAAGT
..................................................(((((.((((((((((.(((((.((((.(((......))).))))))))).)))))))).)))))))...................................................
...........................................................60.................................................................127..........................................................
SizePerfect hitTotal NormPerfect NormSRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR073954(GSM629280)
total RNA. (blood)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (liver)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR390298(GSM849856)
cell line: NIH-3T3cell type: fibroblastinfect. (fibroblast)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR073955(GSM629281)
total RNA. (blood)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (blood)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		GSM510444(GSM510444)
brain_rep5. (brain)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR069811(GSM610967)
small RNA sequencing; sample 3. (testes)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314558(GSM314558)
ESC wild type (454). (ESC)		GSM416732(GSM416732)
MEF. (cell line)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR051941(GSM545785)
18-32 nt total small RNAs (Mov10l-/-). (mov10L testes)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206942(GSM723283)
other. (brain)		GSM475281(GSM475281)
total RNA. (testes)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509280(GSM509280)
small RNA cloning by length. (testes)
.....................................................................................................CATAACATACACACACACACGT................................................................222169.00169.0023.0023.00-5.0012.0018.501.501.0010.001.004.003.501.501.504.000.505.002.502.003.503.003.50-2.503.501.501.504.00-2.000.50---1.500.501.000.501.501.00--1.50--0.500.500.501.00-1.50--1.00----1.00--0.50--0.50-1.500.50---0.500.50-0.50--------0.500.50-0.50-------0.50---0.50-0.50-0.50-0.50-0.50-0.50---0.50----0.50-
.....................................................................................................CATAACATACACACACACACGTA...............................................................232122.50122.509.00-46.0013.502.5010.003.503.000.504.002.00-3.0010.00-4.501.500.500.50--1.501.000.50-0.50----0.50--0.500.50----0.50------------0.50--0.50----0.50---0.50------------0.50---------------------------0.50-------------
......................................................................................................ATAACATACACACACACACGTAT..............................................................232104.00104.0019.006.00--6.00-9.009.006.002.501.506.505.001.50-0.500.500.505.00-0.501.001.00-0.502.500.50-0.50-1.00-1.001.50---1.500.50-0.501.00-2.502.000.50--0.50--1.000.50-0.50-0.500.50-0.50-0.50-------0.50------1.00-------------------0.50----------------0.50-----
....................................................................................................ACATAACATACACACACACACGT................................................................23299.0099.008.0011.00-2.002.507.004.502.000.501.002.000.500.500.503.001.503.003.50-3.503.500.501.502.000.50-2.50--0.502.003.50--1.502.502.00--1.001.00----0.501.001.500.50-1.00--1.00-0.50-0.501.001.000.50--1.50---0.50--0.500.50-0.50----1.00----0.50---0.50--0.50----0.50-0.50---0.50-0.50----------0.500.50---
.....................................................................................................CATAACATACACACACACACGTAT..............................................................24281.0081.0010.504.00-2.003.50-5.006.501.5012.503.50-5.00-0.501.000.500.501.50-0.500.501.002.00-2.000.50-4.500.501.000.50-1.00---0.50--1.000.50---0.50---------0.50-1.00-0.50--0.50-0.50----0.50--0.50------0.50-0.50---0.50-------------0.50----------------0.50--
......................................................................................................ATAACATACACACACACACGT................................................................21267.0067.008.502.00-2.506.00-3.001.002.000.500.506.500.501.003.502.002.50-0.502.502.001.001.000.500.50--1.50-0.50-0.502.00--1.000.500.500.500.500.50----------0.500.50-0.500.500.50---1.00-0.50--1.00--0.50-----0.50--0.50-0.50-0.501.00--------0.50---------------------------
......................................................................................................ATAACATACACACACACACGTA...............................................................22263.0063.006.001.00-15.507.501.503.502.001.50-1.50-2.505.00-3.000.501.001.00-0.50-1.500.500.50---0.500.50--0.50----0.50---1.00--0.500.50-----0.50--0.50-0.50----0.50----------------------0.50------------------------0.50---------
....................................................................................................ACATAACATACACACACACACG.................................................................22222.5022.50-4.00----0.500.502.00-2.00-0.50-3.500.50-----0.501.50-------0.50-0.501.50----1.00-------1.00---------------0.50----0.50--0.50--0.50-0.50-------------------------------------------
.....................................................................................................CATAACATACACACACACACG.................................................................2128.508.50-1.00----1.000.500.50-0.502.00-------0.50---------1.00------------------0.50----------------0.50-----------------------------------------0.50-----------
....................................................................................................ACATAACATACACACACACACGTA...............................................................2428.008.00---1.50---1.00--0.50---0.500.50-0.50-0.500.50-0.50-0.50-0.50--------------------0.50---------------------------------------------0.50-------------------------
....................................................................................................ACATAACATACACACACACACGTAT..............................................................2527.507.501.50-----0.50--1.00-------1.00------0.50-0.50---------------0.50------1.50-0.50-------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGTt...............................................................24T4.0099.00-----3.50-----------0.50-----------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTAa..............................................................23A3.0063.00---0.50--------------0.50--0.50-0.50--------------------------------0.50--------------------------------0.50-----------------------------
......................................................................................................ATAACATACACACACACACG.................................................................2022.502.50-------1.00--0.50-----------------------1.00------------------------------------------------------------------------------------
...................................................................................................TACATAACATACACACACACACGT................................................................2422.002.00-------0.500.50---------------0.50------0.50---------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGa................................................................23A2.0022.50-0.50-0.50--0.50-----0.50----------------------------------------------------------------------------------------------------------
...................................................................................................TACATAACATACACACACACAt..................................................................22T2.000.14-0.43---------1.43--------------------0.14--------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAaat................................................................23AAT1.500.000.50---0.50--------------------------------------------0.50---------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTt...............................................................23T1.50169.00--0.500.50-----------0.50-------------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGTAa..............................................................25A1.008.00-------------------------------------0.50---0.50-----------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACtt................................................................21TT1.000.00-------------------------------0.33------0.33-------------0.33------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGca...............................................................23CA1.008.50--1.00--------------------------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTATt.............................................................24T1.00104.00----0.50---------------------------0.50--------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAaa.................................................................22AA1.000.00---1.00-------------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGa................................................................22A1.008.50--------0.50-----------------------------------------------------------------------------------0.50--------------------------
....................................................................................................ACATAACATACACACACACAtgt................................................................23TGT1.000.00-----------------0.50--------------------------------------------------------------------------------------------0.50--------
.......................................................................................................TAACATACACACACACACGTAT..............................................................2221.001.00----------0.50----------0.50-------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACtt................................................................23TT1.000.00----------0.50-----------0.50------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAtg.................................................................22TG1.000.00-0.50------------------------0.50--------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGc................................................................23C1.0022.50---0.50----------0.50--------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACAagta...............................................................23AGTA1.000.00--1.00--------------------------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAagt................................................................23AGT1.000.00----0.50----------------------------------0.50-------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTATt.............................................................25T1.0081.00----------0.50----------------------------------------------------------------------------------------------------0.50-------
...................................................................................................TACATAACATACACACACACAC..................................................................2270.570.57---0.14------0.14-----0.14-----------------------------------------------------------------------------------------------------0.14
.......................................................................................................TAACATACACACACACACGTAa..............................................................22A0.500.00---------0.50-------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTga..............................................................24GA0.50169.00---------------0.50-------------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGTtt..............................................................25TT0.5099.00------------------------------------0.50----------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGTgt..............................................................25GT0.5099.00------------0.50----------------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTATtt............................................................25TT0.50104.00---------------------------------------------------------------------------0.50-------------------------------------------
....................................................................................................ACATAACATACACACACACAgat................................................................23GAT0.500.00-------------------------------------------------0.50---------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACatat..............................................................25ATAT0.500.00--------------------------------------------------------------------------------0.50--------------------------------------
.....................................................................................................CATAACATACACACACACACGTAaa.............................................................25AA0.50122.50-------------0.50---------------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAtata...............................................................24TATA0.500.00--------------------------------------------------------------------------------0.50--------------------------------------
....................................................................................................ACATAACATACACACACACACct................................................................23CT0.500.00-----------------------------------0.50-----------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTta..............................................................24TA0.50169.00----------------------------------------------------0.50------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACAtata...............................................................23TATA0.500.00--0.50--------------------------------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGTATt.............................................................26T0.507.50-0.50---------------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACtt................................................................22TT0.500.00-----------------------------0.50-----------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAa..................................................................21A0.500.00----------------------------------------------------------------------------------------0.50------------------------------
......................................................................................................ATAACATACACACACACACGTct..............................................................23CT0.5067.00------------------------------------------0.50----------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAg..................................................................21G0.500.00-------------------0.50---------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTtt..............................................................23TT0.5067.00---------------------------------0.50-------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTAag.............................................................24AG0.5063.00------------0.50----------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACAagt................................................................22AGT0.500.00------------------------------------------------------0.50----------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGc................................................................21C0.502.50----------0.50------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTAa..............................................................24A0.50122.50------0.50----------------------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGcat..............................................................23CAT0.502.50--------0.50--------------------------------------------------------------------------------------------------------------
........................................................................................................AACATACACACACACACGTAT..............................................................2120.500.50-----------------0.50-----------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGga...............................................................23GA0.508.50--------0.50--------------------------------------------------------------------------------------------------------------
...................................................................................................TACATAACATACACACACACACG.................................................................2320.500.50--------------------------------0.50--------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACACGcat..............................................................25CAT0.5022.50----------0.50------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACAtgt................................................................22TGT0.500.00--------------------------------------------------------------------0.50--------------------------------------------------
.....................................................................................................CATAACATACACACACACACtta...............................................................23TTA0.500.00-------------------------0.50---------------------------------------------------------------------------------------------
....................................................................................................ACATAACATACACACACACAtgta...............................................................24TGTA0.500.00----------0.50------------------------------------------------------------------------------------------------------------
......................................................................................................ATAACATACACACACACACGTATc.............................................................24C0.50104.00------0.50----------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGg................................................................22G0.508.50-0.50---------------------------------------------------------------------------------------------------------------------
.....................................................................................................CATAACATACACACACACACGTc...............................................................23C0.50169.00--0.50--------------------------------------------------------------------------------------------------------------------
........................................................................................................AACATACACACACACACGT................................................................1990.440.44-------------------------------0.11----0.22----------------0.11-----------------------------------------------------------------
......................................................................................................ATAACATACACACACACACctat..............................................................23CTAT0.330.00-----------0.33-----------------------------------------------------------------------------------------------------------
...................................................................................................TACATAACATACACACACACA...................................................................2170.140.14-----------------------0.14-----------------------------------------------------------------------------------------------
AAATTCATACTTATCCTCATGAGAGATCAGCCTGTGATTCCTCCATGTATGTGCATGTGTGTATAGTTGTGTGTGCATGTTCATGTCTATATTTGAATATACATAACATACACACACACACGTATAAACGCAAGCACACATACACAGACACAGGAATGGCATTCGCCAATCCCTTTGAATGATAAGT
..................................................(((((.((((((((((.(((((.((((.(((......))).))))))))).)))))))).)))))))...................................................
...........................................................60.................................................................127..........................................................
SizePerfect hitTotal NormPerfect NormSRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR390297(GSM849855)
cell line: NIH-3T3cell type: fibroblastip ant. (fibroblast)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR279906(GSM689056)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR029036(GSM433288)
18dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR042470(GSM539862)
mouse Th17 cells [09-002]. (lymph)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR029123(GSM416611)
NIH3T3. (cell line)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR073954(GSM629280)
total RNA. (blood)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR029038(GSM433290)
25dpp_hetero_tdrd6-KO. (tdrd6 testes)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR279905(GSM689055)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR059770(GSM562832)
Treg_Dicer. (spleen)		SRR029037(GSM433289)
18dpp_homo_tdrd6-KO. (tdrd6 testes)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		SRR042473(GSM539865)
mouse nTreg cells [09-002]. (lymph)		SRR069810(GSM610966)
small RNA sequencing; sample 2. (testes)		SRR029043(GSM433295)
18.5dpc_homo_tdrd1-KO. (tdrd1 testes)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (liver)		SRR042475(GSM539867)
mouse embryonic fibroblast cells [09-002]. (fibroblast)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR023852(GSM307161)
ZHBT-c424hsmallrna_rep1. (cell line)		SRR042465(GSM539857)
mouse CD4+ T cells (spleen) [09-002]. (spleen)		SRR248527(GSM733815)
cell type: spermatogonial stem cell enriched . (testes)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR390298(GSM849856)
cell line: NIH-3T3cell type: fibroblastinfect. (fibroblast)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR059769(GSM562831)
Treg_Drosha. (spleen)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		SRR042456(GSM539848)
mouse hematopoetic progenitor cells [09-002]. (bone marrow)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR306540(GSM750583)
19-24nt. (ago2 brain)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR059766(GSM562828)
DN3_Drosha. (thymus)		SRR073955(GSM629281)
total RNA. (blood)		SRR032477(GSM485235)
sRNA_activation_deep_sequencing. (uterus)		SRR116846(GSM678422)
Small RNA deep sequencing from mouse epididym. (blood)		SRR032476(GSM485234)
sRNA_delayed_deep_sequencing. (uterus)		GSM510444(GSM510444)
brain_rep5. (brain)		mjTestesKO6()
Testes Data. (Zcchc11 testes)		SRR069811(GSM610967)
small RNA sequencing; sample 3. (testes)		SRR042472(GSM539864)
mouse iTreg cells [09-002]. (lymph)		SRR037905(GSM510441)
brain_rep2. (brain)		GSM475280(GSM475280)
Mili-IP. (mili testes)		SRR248523(GSM733811)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR023851(GSM307160)
ZHBT-c412hsmallrna_rep1. (cell line)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		GSM314558(GSM314558)
ESC wild type (454). (ESC)		GSM416732(GSM416732)
MEF. (cell line)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR306541(GSM750584)
19-24nt. (ago2 brain)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		SRR306539(GSM750582)
19-24nt. (ago2 brain)		SRR042453(GSM539845)
mouse marginal zone B cells (spleen) [09-002]. (b cell)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR042458(GSM539850)
mouse basophil cells [09-002]. (b cell)		SRR051941(GSM545785)
18-32 nt total small RNAs (Mov10l-/-). (mov10L testes)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		GSM509276(GSM509276)
small RNA cloning by length. (testes)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		SRR042484(GSM539876)
mouse salivary gland tissue [09-002]. (gland)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR038744(GSM527279)
small RNA-Seq. (brain)		mjTestesKO8()
Testes Data. (Zcchc11 testes)		SRR042463(GSM539855)
mouse natural killer cells [09-002]. (spleen)		SRR039610(GSM527274)
small RNA-Seq. (brain)		SRR042477(GSM539869)
mouse brain tissue [09-002]. (brain)		Ago1IP517(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		SRR037901(GSM510437)
testes_rep2. (testes)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR306527(GSM750570)
19-24nt. (ago2 brain)		SRR034119(GSM466729)
Mili IP_Tdrd9+/- replicate2. (mili testes)		SRR038741(GSM527276)
small RNA-Seq. (brain)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR206942(GSM723283)
other. (brain)		GSM475281(GSM475281)
total RNA. (testes)		GSM510456(GSM510456)
newborn_rep12. (total RNA)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		GSM509280(GSM509280)
small RNA cloning by length. (testes)