| (2) AGO1.ip | (3) AGO2.ip | (1) AGO3.ip | (2) BRAIN | (1) CELL-LINE | (2) ESC | (1) OTHER.mut | (5) SKIN | (1) TESTES |
| TTGTCCATGGTGAGACCTAGGAGATTGGCTGTAGGGGCTTCTGGGTTTGATGCCCTTATAACTTGAGGGGCATGAGGATAGTCAGTAGTCCAACATCCCTCTTGATGGCACATTGCACATAGTTGCAATGGCTTATGAGGTCTTGTTCAGACACAGGCACAATGTCCTT ..................................................(((((((........)))))))........((((((.(((((.((.......)).))).)))))).))................................................... ..................................................51..................................................................119................................................ | Size | Perfect hit | Total Norm | Perfect Norm | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR037936(GSM510474) 293cand1. (cell line) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | Ago1IP812(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | Ago2IP517(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR029038(GSM433290) 25dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................ACTTGAGGGGCATGAGGAT.......................................................................................... | 19 | 1 | 6.00 | 6.00 | 1.00 | 2.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - |
| ............................................................ACTTGAGGGGCATGAGGct.......................................................................................... | 19 | CT | 4.00 | 0.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - |
| .............................................................CTTGAGGGGCATGAGGgt.......................................................................................... | 18 | GT | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - |
| ...................................................................GGGCATGAGGATAGTCA..................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..............................GTAGGGGCTTCTGGGTTTGATGCCCTTATA............................................................................................................. | 30 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ............AGACCTAGGAGATTGtata.......................................................................................................................................... | 19 | TATA | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ................CTAGGAGATTGGCTGTAGGGGC................................................................................................................................... | 22 | 2 | 0.50 | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ........................................................................................................................AGTTGCAATGGCTTA.................................. | 15 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | 0.17 |
| TTGTCCATGGTGAGACCTAGGAGATTGGCTGTAGGGGCTTCTGGGTTTGATGCCCTTATAACTTGAGGGGCATGAGGATAGTCAGTAGTCCAACATCCCTCTTGATGGCACATTGCACATAGTTGCAATGGCTTATGAGGTCTTGTTCAGACACAGGCACAATGTCCTT ..................................................(((((((........)))))))........((((((.(((((.((.......)).))).)))))).))................................................... ..................................................51..................................................................119................................................ | Size | Perfect hit | Total Norm | Perfect Norm | Ago2IP504(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR306541(GSM750584) 19-24nt. (ago2 brain) | SRR037936(GSM510474) 293cand1. (cell line) | Ago3IP805(Rui) Quantitative functions of Argonaute proteins . (ago3 skin) | SRR345197(SRX097258) source: size fractionated RNA from mouse hipp. (brain) | Ago1IP517(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | Ago1IP812(Rui) Quantitative functions of Argonaute proteins . (ago1 skin) | SRR279903(GSM689053) cell type: mouse embryonic stem cellcell line. (ESC) | Ago2IP517(Rui) Quantitative functions of Argonaute proteins . (ago2 skin) | SRR029038(GSM433290) 25dpp_hetero_tdrd6-KO. (tdrd6 testes) | SRR402762(SRX117945) source: ES E14 male cells. (ESC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......ATGGTGAGACCTAGGAGATTGGCTGTA........................................................................................................................................ | 27 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | 0.50 | - |