ID: mmu-mir-3112
chrX:130609805-130609986 +
Display Libraries
(1)
AGO1.ip 		(9)
AGO2.ip 		(2)
AGO3.ip 		(10)
B-CELL 		(13)
BRAIN 		(6)
CELL-LINE 		(1)
DGCR8.mut 		(15)
EMBRYO 		(9)
ESC 		(7)
FIBROBLAST 		(1)
HEART 		(1)
KIDNEY 		(3)
LIVER 		(1)
LYMPH 		(8)
OTHER 		(3)
OTHER.mut 		(1)
PIWI.ip 		(1)
PIWI.mut 		(4)
SKIN 		(5)
SPLEEN 		(11)
TESTES 		(3)
THYMUS 		(1)
TOTAL-RNA
Showing top 55 reads
ATCATCTCAGGGTGACAGAAACCTATGTAGATTTCTTGTCATCACAACATCTAAATGAACAGTGACATAGAAAAGGCAGTCTGCATTTATTCTGGAGCTGCAGTTTGTCTCTTCTTTGTCTCTGTCAGTTGGTTTGCTCCAGTTGTGCCTATGGGATGCTTTGTAGTAGTCATTTCCTCATT
..................................................(((.((((.((((.((((((.((((((((......))).))))).)))))).)))).)))).)))...................................................
...........................................................60...............................................................125.......................................................
SizePerfect hitTotal NormPerfect NormSRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR073955(GSM629281)
total RNA. (blood)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (liver)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR073954(GSM629280)
total RNA. (blood)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		GSM475281(GSM475281)
total RNA. (testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT3()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR037932(GSM510470)
293cand4_rep1. (cell line)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		GSM361394(GSM361394)
CGNP_P6_wt_rep1. (brain)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		GSM566419(GSM566419)
Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection. (fibroblast)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM361399(GSM361399)
CGNP_P6_p53--_Ink4c--_rep2. (brain)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
................................................................ACATAGAAAAGGCAGTCTGCA.................................................................................................211230.00230.0049.0033.0034.0012.009.002.003.005.005.004.006.006.002.003.003.003.005.002.001.005.00--1.00-2.00-1.00-1.002.00--3.001.00--1.00-2.00-2.002.001.001.00-1.00-2.00-1.00-----------1.00--1.00-1.001.00----1.001.001.00--------1.00--1.00--1.001.001.00----1.001.00
................................................................ACATAGAAAAGGCAGTCTGCAa................................................................................................22A107.00230.0035.0023.0016.001.002.001.002.002.00---1.001.002.001.001.00--1.00---2.00-----1.001.00---------2.00--1.001.001.00-2.00-2.00-----------1.00-------1.00-1.00-----------1.00-----------1.00---
................................................................ACATAGAAAAGGCAGTCTGC..................................................................................................20190.0090.0016.0025.0011.00---3.00-4.003.00--1.00-1.001.00--1.00-2.001.00-4.001.00-1.003.00---2.00---1.00--------------2.00----1.00-1.00-----1.00-----1.00-1.00----------------1.00------1.00--
................................................................ACATAGAAAAGGCAGTCTGCAT................................................................................................22139.0039.0014.004.0010.00----------1.001.00--1.001.00------3.00--1.00-1.00-----1.001.00------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAaa...............................................................................................23AA16.00230.003.002.002.00-3.00-------1.00---------1.00-------1.00-------------1.00------2.00----------------------------------------------
....................................................................................................CAGTTTGTCTCTTCTTTGTCT.............................................................21112.0012.00-------1.00------1.00--1.00---------------2.00-2.00-----------------------------------------1.00--1.001.00---1.00------1.00-----
................................................................ACATAGAAAAGGCAGTCT....................................................................................................1819.009.00-----5.00----------------------------1.00-1.00----------------------1.00----------------1.00---------------------
................................................................ACATAGAAAAGGCAGTCTGCAat...............................................................................................23AT7.00230.003.002.001.00--------------1.00--------------------------------------------------------------------------------
.................................................................CATAGAAAAGGCAGTCTGCAT................................................................................................2113.003.002.00-----------------1.00-------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGa..................................................................................................20A3.003.00------------------------1.00--------------------1.00-----------------------------1.00----------------------
................................................................ACATAGAAAAGGCAGTCTG...................................................................................................1913.003.00-1.001.00--1.00--------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCATT...............................................................................................2312.002.00-------------------------1.00----------------------------------------------------------1.00-------------
.........................................................AACAGTGACATAGAAAAGGCAG.......................................................................................................2212.002.00------1.00-----------------------------------------------1.00-------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAca...............................................................................................23CA2.00230.00--------------------------2.00-----------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAag...............................................................................................23AG2.00230.001.00------------------------------1.00------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAacaa.............................................................................................25ACAA2.00230.00--1.00----------1.00------------------------------------------------------------------------------------
............................AGATTTCTTGTCATCACAACATCT..................................................................................................................................2412.002.00------------1.00--------------1.00----------------------------------------------------------------------
...............................................................GACATAGAAAAGGCAGTCTGCATTT..............................................................................................2512.002.00--2.00-----------------------------------------------------------------------------------------------
....................................................................................................CAGTTTGTCTCTTCTTTGTC..............................................................2012.002.00--------------------1.001.00----------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAac...............................................................................................23AC1.00230.00-1.00------------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAg................................................................................................22G1.00230.00---------------1.00----------------------------------------------------------------------------------
............................................................AGTGACATAGAAAAGGCAG.......................................................................................................1911.001.00-----------------------------------------------------1.00--------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGaat................................................................................................22AAT1.003.00-------------------------------------------------1.00------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAata..............................................................................................24ATA1.00230.00-----1.00--------------------------------------------------------------------------------------------
........................................................GAACAGTGACATAGAAAAGGCAGT......................................................................................................2411.001.00----------1.00---------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAaga..............................................................................................24AGA1.00230.00-1.00------------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTtca.................................................................................................21TCA1.009.00----------------------------------1.00---------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTctga................................................................................................22CTGA1.009.001.00-------------------------------------------------------------------------------------------------
............................................................................................................................................AGTTGTGCCTATGGGAgtcc......................20GTCC1.000.00-------------------------------------------------------------------------------1.00------------------
................................................................ACATAGAAAAGGCAGTCTGCc.................................................................................................21C1.0090.00---------------------1.00----------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGat.................................................................................................21AT1.003.00-------------------------------------1.00------------------------------------------------------------
.................................................................CATAGAAAAGGCAGTCTGCA.................................................................................................2011.001.001.00-------------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAagt..............................................................................................24AGT1.00230.001.00-------------------------------------------------------------------------------------------------
.......................................................................................................................CTCTGTCAGTTGGTTTGCTC...........................................2011.001.00--------------------------------------------------------------1.00-----------------------------------
...................................................................TAGAAAAGGCAGTCTGCA.................................................................................................1811.001.00----1.00---------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGaaa................................................................................................22AAA1.003.00--------------------------------------------------------1.00-----------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCg.................................................................................................21G1.0090.00----------------------------------1.00---------------------------------------------------------------
........................................................................................ATTCTGGAGCTGCAGagaa...........................................................................19AGAA1.000.00------------1.00-------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGtt.................................................................................................21TT1.003.001.00-------------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGgat................................................................................................22GAT1.003.00----------------------------------------------------------1.00---------------------------------------
.............................................................GTGACATAGAAAAGGCAGTCTGCA.................................................................................................2411.001.00------------------------------1.00-------------------------------------------------------------------
...............................................................GACATAGAAAAGGCAGTCTGC..................................................................................................2111.001.00-1.00------------------------------------------------------------------------------------------------
.....................................................AATGAACAGTGACATcccc..............................................................................................................19CCCC1.000.00-------1.00------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCt.................................................................................................21T1.0090.00-1.00------------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGt..................................................................................................20T1.003.00--------------------1.00-----------------------------------------------------------------------------
.................................................................CATAGAAAAGGCAGTCTGC..................................................................................................1911.001.00---1.00----------------------------------------------------------------------------------------------
.................................................................CATAGAAAAGGCAGTCTGCATT...............................................................................................2211.001.001.00-------------------------------------------------------------------------------------------------
.............................................AACATCTAAATGAACAGTG......................................................................................................................1911.001.00----------------------------------------------------1.00---------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAaat..............................................................................................24AAT1.00230.001.00-------------------------------------------------------------------------------------------------
..............................................................TGACATAGAAAAGGCAGTCTGC..................................................................................................2211.001.00---1.00----------------------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGTCTGCAgt...............................................................................................23GT1.00230.00---------------------1.00----------------------------------------------------------------------------
................................................................................................................................................GTGCCTATGGGATGCTT.....................1720.500.50---------------0.50----------------------------------------------------------------------------------
................................................................ACATAGAAAAGGCAGT......................................................................................................1680.120.12-0.12------------------------------------------------------------------------------------------------
ATCATCTCAGGGTGACAGAAACCTATGTAGATTTCTTGTCATCACAACATCTAAATGAACAGTGACATAGAAAAGGCAGTCTGCATTTATTCTGGAGCTGCAGTTTGTCTCTTCTTTGTCTCTGTCAGTTGGTTTGCTCCAGTTGTGCCTATGGGATGCTTTGTAGTAGTCATTTCCTCATT
..................................................(((.((((.((((.((((((.((((((((......))).))))).)))))).)))).)))).)))...................................................
...........................................................60...............................................................125.......................................................
SizePerfect hitTotal NormPerfect NormSRR391845(GSM852140)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR391847(GSM852142)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391846(GSM852141)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR042449(GSM539841)
mouse B cells activated in vitro with LPS/IL4 replicate 2 [09-002]. (b cell)		SRR391852(GSM852147)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR402762(SRX117945)
source: ES E14 male cells. (ESC)		SRR279903(GSM689053)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR279904(GSM689054)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR391851(GSM852146)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR402766(SRX117949)
source: ES PGK female cells. (ESC)		SRR391849(GSM852144)
gender: femalegenotype/variation: ADAR2-/-tis. (embryo)		SRR039185(GSM485325)
shLuc.1309;ROSA-rtTA (-dox). (fibroblast)		SRR391853(GSM852148)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR391848(GSM852143)
gender: femalegenotype/variation: wild typeti. (embryo)		SRR390299(GSM849857)
cell line: NIH-3T3cell type: fibroblastip ant. (ago2 fibroblast)		SRR037921(GSM510459)
e12p5_rep3. (embryo)		SRR039186(GSM485326)
shLuc.1309;ROSA-rtTA (+dox). (fibroblast)		SRR042469(GSM539861)
mouse Th2 cells [09-002]. (lymph)		SRR059765(GSM562827)
DN3_control. (thymus)		SRR059767(GSM562829)
DN3_Dicer. (thymus)		SRR402761(SRX117944)
source: ES E14 male cells. (ESC)		SRR279907(GSM689057)
cell type: mouse embryonic stem cellcell line. (ESC)		SRR039184(GSM485324)
shLuc.1309 (+dox). (fibroblast)		SRR042459(GSM539851)
mouse neutrophil cells replicate 1 [09-002]. (blood)		SRR040488(GSM533911)
E18.5 wild type LIVER small RNA. (liver)		SRR391850(GSM852145)
gender: femalegenotype/variation: ADAR2-/-/AD. (embryo)		SRR042467(GSM539859)
mouse T cells activated in vitro with Concanavalin A [09-002]. (spleen)		SRR039183(GSM485323)
shLuc.1309 (-dox). (fibroblast)		SRR042454(GSM539846)
mouse germinal center B cells (lymph node) [09-002]. (b cell)		SRR073955(GSM629281)
total RNA. (blood)		SRR037924(GSM510462)
e9p5_rep2. (embryo)		SRR306534(GSM750577)
19-24nt. (ago2 brain)		SRR042450(GSM539842)
mouse B cells activated in vitro with LPS/IL4 replicate 3 [09-002]. (b cell)		SRR248525(GSM733813)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042487(GSM539879)
mouse BclXL B activated with LPS/IL4 [BalbC] [09-002]. (spleen)		SRR042480(GSM539872)
mouse kidney tissue [09-002]. (kidney)		SRR042448(GSM539840)
mouse B cells activated in vitro with LPS/IL4 replicate 1 [09-002]. (b cell)		SRR306537(GSM750580)
19-24nt. (ago2 brain)		SRR306533(GSM750576)
19-24nt. (ago2 brain)		SRR402760(SRX117943)
source: ES E14 male cells. (ESC)		SRR040489(GSM533912)
E18.5 Ago2 catalytically inactive LIVER small RNA. (liver)		SRR069809(GSM610965)
small RNA sequencing; sample 1. (testes)		SRR042466(GSM539858)
mouse CD8+ T cells (spleen) [09-002]. (spleen)		GSM314552(GSM314552)
ESC wild type (Illumina). (ESC)		SRR073954(GSM629280)
total RNA. (blood)		SRR037925(GSM510463)
e9p5_rep3. (embryo)		SRR042443(GSM539835)
mouse pro B cells [09-002]. (b cell)		SRR042451(GSM539843)
mouse B cells activated in vitro with LPS/aIgD-Dextran [09-002]. (b cell)		GSM475281(GSM475281)
total RNA. (testes)		SRR390300(GSM849858)
cell line: NIH-3T3cell type: fibroblastinfect. (ago2 fibroblast)		SRR248524(GSM733812)
cell type: Thy1+ spermatogonial stem cellstra. (testes)		mjTestesKO7()
Testes Data. (Zcchc11 testes)		mjTestesWT3()
Testes Data. (testes)		Ago3IP805(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		SRR023850(GSM307159)
ZHBT-c40hsmallrna_rep1. (cell line)		SRR248526(GSM733814)
cell type: Thy1- spermatogonial stem cellstra. (testes)		SRR042447(GSM539839)
mouse mature B cells (spleen) replicate 2 [09-002]. (b cell)		SRR042488(GSM539880)
mouse BclXL germinal center B cells [BalbC] [09-002]. (B cell)		SRR037932(GSM510470)
293cand4_rep1. (cell line)		SRR306542(GSM750585)
19-24nt. (ago2 brain)		SRR039153(GSM471930)
HL1_siSrf1_smallRNAseq. (muscle)		GSM519104(GSM519104)
mouse_granulocyte_nuclei_smallRNAs. (cell line)		GSM475279(GSM475279)
Miwi-IP. (miwi testes)		GSM361394(GSM361394)
CGNP_P6_wt_rep1. (brain)		SRR037928(GSM510466)
e7p5_rep2. (embryo)		SRR037912(GSM510449)
newborn_rep5. (total RNA)		SRR042471(GSM539863)
mouse TFHS cells [09-002]. (spleen)		SRR038742(GSM527277)
small RNA-Seq. (dgcr8 brain)		SRR037920(GSM510458)
e12p5_rep2. (embryo)		GSM566419(GSM566419)
Endougenous small RNA from mouse NIH3T3 cells, without MHV-68 infection. (fibroblast)		SRR059768(GSM562830)
Treg_control. (spleen)		SRR042445(GSM539837)
mouse immature B cells [09-002]. (b cell)		SRR306535(GSM750578)
19-24nt. (ago2 brain)		SRR037906(GSM510442)
brain_rep3. (brain)		SRR042455(GSM539847)
mouse plasma cells [09-002]. (blood)		SRR029042(GSM433294)
18.5dpc_hetero_tdrd1-KO. (tdrd1 testes)		GSM361395(GSM361395)
CGNP_P6_wt_rep2. (brain)		SRR029040(GSM433292)
6w_hetero_tdrd6-KO. (tdrd6 testes)		Ago3IP812(Rui)
Quantitative functions of Argonaute proteins . (ago3 skin)		Ago1IP812(Rui)
Quantitative functions of Argonaute proteins . (ago1 skin)		SRR042452(GSM539844)
mouse B1 B cells [09-002]. (b cell)		SRR037929(GSM510467)
e7p5_rep3. (embryo)		SRR042483(GSM539875)
mouse muscle tissue [09-002]. (muscle)		SRR095855BC7(SRX039178)
sequencing of miRNA from wild type and diseas. (heart)		SRR042464(GSM539856)
mouse CD4+CD8+ T cells (thymus) [09-002]. (thymus)		GSM361399(GSM361399)
CGNP_P6_p53--_Ink4c--_rep2. (brain)		SRR345206(SRX097267)
source: size fractionated RNA from mouse hipp. (brain)		GSM261957(GSM261957)
oocytesmallRNA-19to24. (oocyte)		GSM509277(GSM509277)
small RNA cloning by length. (piwi testes)		SRR023847(GSM307156)
mESv6.5smallrna_rep1. (cell line)		Ago2IP517(Rui)
Quantitative functions of Argonaute proteins . (ago2 skin)		GSM361402(GSM361402)
CGNP_P6_p53--_Ink4c--_rep5. (brain)		SRR042461(GSM539853)
mouse dendritic cells [09-002]. (bone marrow)		SRR077866(GSM637803)
18-30 nt small RNAs. (liver)		SRR306538(GSM750581)
19-24nt. (ago2 brain)		SRR042474(GSM539866)
mouse embryonic stem cells [09-002]. (ESC)
................................................................ACATAGAAAAGGCAGTCTGCA................................................................................................. 2112.002.00------------------------------------------------------------------------------1.00--------------1.00----
................................................................ACATAGAAAAGGCAGTCTGCAT................................................................................................ 2212.002.00-----------------------------------------------------------------1.00---------------------1.00----------
...................................................................................................GCAGTTTGTCTCTTCT................................................................... 1680.120.12----------------------------------------------------0.12---------------------------------------------