| (4) BRAIN | (3) BREAST | (6) CELL-LINE | (1) FIBROBLAST | (7) HEART | (2) LIVER | (3) OTHER | (1) OVARY | (16) SKIN | (1) TESTES | (3) UTERUS |
| CCTCCGGCATTTTTGGCTCTTGCCTTTTAGGGTTGCCAGATTAAAAGACAGGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATTTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATCTGAGATTCAAAATTAAGCATTTTATATTTTATTTGCTGCCTCTGGCCACCCTACTCTCTTCCTAACACTCTCTC ......................................................(((..((((((((.(((.((((((((...)))))))).))).))))))))..))).................................................. .......................................................................................88........................................................146.......................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR314796(SRX084354) Total RNA, fractionated (15-30nt). (cell line) | SRR189783 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139197(SRX050645) FLASHPage purified small RNA (~15-40nt) from . (ovary) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR139164(SRX050631) FLASHPage purified small RNA (~15-40nt) from . (heart) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191627(GSM715737) 45genomic small RNA (size selected RNA from t. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577580(Rovira) total RNA. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189784 | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139208(SRX050635) FLASHPage purified small RNA (~15-40nt) from . (testes) | TAX577739(Rovira) total RNA. (breast) | SRR139179(SRX050638) FLASHPage purified small RNA (~15-40nt) from . (liver) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................GTAGCATAAATATTTCCCAAGC......................................................................................................................... | 22 | 1 | 12.00 | 12.00 | - | 1.00 | 3.00 | 2.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATTTCCCAAG.......................................................................................................................... | 21 | 1 | 11.00 | 11.00 | 7.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATTTCCCAA........................................................................................................................... | 20 | 1 | 4.00 | 4.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................TTGTTTATCTGAGATTCAAAAT............................................................. | 22 | 1 | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TTCGTAGCATAAATATTTCCCAA........................................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATTTCCCAAG.......................................................................................................................... | 20 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................TTATTGGTTGTTTATCTGAGAatc.................................................................. | 24 | ATC | 1.40 | 0.00 | - | - | - | - | - | - | 1.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TGAGATTCAAAATTAggat....................................................... | 19 | GGAT | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................CGTAGCATAAATATTTCCCAAGCTT....................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATTTCCCAAGCa........................................................................................................................ | 23 | A | 1.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TCAAAATTAAGCATTTTg.................................................. | 18 | G | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATTTCCaaag.......................................................................................................................... | 20 | AAAG | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................TTTCGTAGCATAAATATTTCCCA............................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TCGTAGCATAAATATTTCCCAAG.......................................................................................................................... | 23 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TCGTAGCATAAATATTTCCCAA........................................................................................................................... | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................TTTCGTAGCATAAATATTTCCC............................................................................................................................. | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TTCGTAGCATAAATATTTCCC............................................................................................................................. | 21 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATTTCCCAAt.......................................................................................................................... | 21 | T | 1.00 | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATTTCCCAAGCTT....................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACG........................................................................................................................................................ | 22 | 6 | 0.67 | 0.67 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | 0.17 | - | 0.17 | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGAAT..................................................................................................................................................... | 25 | 6 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGA....................................................................................................................................................... | 23 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | 0.17 | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGAATA.................................................................................................................................................... | 26 | 6 | 0.33 | 0.33 | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - |
| .............................................................................................................................................AAAAACATTATTGGTTGTTTAT........................................................................... | 22 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................GCCAGATTAAAAGACAGG.......................................................................................................................................................................................... | 18 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTAA................................................................................................ | 26 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTA................................................................................................. | 25 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAAT..................................................................................................................................................... | 23 | 7 | 0.29 | 0.29 | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGA....................................................................................................................................................... | 21 | 7 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................AGTTTGGGACATACTTATGCTAtt............................................................................................... | 24 | TT | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................ATTTTATTTGCTGCCTCgg.............................. | 19 | GG | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TCGTAGCATAAATATcccc.............................................................................................................................. | 19 | CCCC | 0.20 | 0.00 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................TTATTGGTTGTTTATCTGAGAa.................................................................... | 22 | A | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................TTAGATAAACAACGAAattt.................................................................................................................................................. | 20 | ATTT | 0.20 | 0.00 | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................TGCTGCCTCTGGCCACCCTACTCTCTaaaa........... | 30 | AAAA | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATTATTGGTTGTTTATCTtata..................................................................... | 22 | TATA | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................TTAGATAAACAACGAATAATTT................................................................................................................................................ | 22 | 6 | 0.17 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................GATTAAAAGACAGGATGCCCAGCTAGTT............................................................................................................................................................................ | 28 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAA...................................................................................................................................................... | 22 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................TTTTAGATAAACAACGAATA.................................................................................................................................................... | 20 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAAa..................................................................................................................................................... | 23 | A | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| ...........................................................................................................................................................TTGTTTATCTGAGATTCAA................................................................ | 19 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................TTTGGGACATACTTATGCTAAta.............................................................................................. | 23 | TA | 0.10 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.10 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CCTCCGGCATTTTTGGCTCTTGCCTTTTAGGGTTGCCAGATTAAAAGACAGGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATTTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATCTGAGATTCAAAATTAAGCATTTTATATTTTATTTGCTGCCTCTGGCCACCCTACTCTCTTCCTAACACTCTCTC ......................................................(((..((((((((.(((.((((((((...)))))))).))).))))))))..))).................................................. .......................................................................................88........................................................146.......................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR314796(SRX084354) Total RNA, fractionated (15-30nt). (cell line) | SRR189783 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139197(SRX050645) FLASHPage purified small RNA (~15-40nt) from . (ovary) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR139164(SRX050631) FLASHPage purified small RNA (~15-40nt) from . (heart) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191627(GSM715737) 45genomic small RNA (size selected RNA from t. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577580(Rovira) total RNA. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189784 | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139208(SRX050635) FLASHPage purified small RNA (~15-40nt) from . (testes) | TAX577739(Rovira) total RNA. (breast) | SRR139179(SRX050638) FLASHPage purified small RNA (~15-40nt) from . (liver) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................TCGTAGCATAAATATTTCCCA............................................................................................................................ | 21 | 1 | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TCGTAGCATAAATATTTCCCAA........................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................ctcCTGGCCACCCTACTCT................. | 19 | ctc | 0.60 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.60 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTA................................................................................................. | 25 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................TACTCTCTTCCTAACACTCTCT. | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................CCCTACTCTCTTCCTAACACTC.... | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................ACCCTACTCTCTTCCTAACAC...... | 21 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................GCCACCCTACTCTCTTCCTAAC........ | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................AGTTTGGGACATACTTATGCTAAA............................................................................................... | 24 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |