| (6) BRAIN | (3) BREAST | (6) CELL-LINE | (7) HEART | (1) LIVER | (1) LUNG | (1) OTHER | (1) PLACENTA | (22) SKIN | (1) TESTES | (2) THYMUS | (2) UTERUS |
| CCTCCGGCATTTTTGGCCCTTGCCTTTTAGGGTTGCCAGATTAAAAGACAGGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATCTGAGATTCAGAATTAAGCATTTTATATTTTATTTGCTGCCTCTGGCCACCCTACTCTCTTCCTAACACTCTCTC ...................................................((((........)))).......(((((....)))))(((((((.((((((((((((...)))))))))))).)))))))........................................................ ...........................................................60....................................................................................146.......................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR314796(SRX084354) Total RNA, fractionated (15-30nt). (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR189786 | SRR189784 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189783 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR139216(SRX050633) FLASHPage purified small RNA (~15-40nt) from . (thymus) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139185(SRX050632) FLASHPage purified small RNA (~15-40nt) from . (lung) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR139200(SRX050639) FLASHPage purified small RNA (~15-40nt) from . (placenta) | SRR139219(SRX050655) FLASHPage purified small RNA (~15-40nt) from . (thymus) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139208(SRX050635) FLASHPage purified small RNA (~15-40nt) from . (testes) | TAX577739(Rovira) total RNA. (breast) | SRR139179(SRX050638) FLASHPage purified small RNA (~15-40nt) from . (liver) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................GTAGCATAAATATGTCCCAAGCT........................................................................................................................ | 23 | 4 | 1.50 | 1.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................TTATTGGTTGTTTATCTGAGAatc.................................................................. | 24 | ATC | 1.40 | 0.00 | - | 1.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAAG.......................................................................................................................... | 20 | 5 | 1.40 | 1.40 | 1.20 | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATGTCCCAAGC......................................................................................................................... | 22 | 4 | 1.00 | 1.00 | - | - | 0.25 | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATGTCCCAAGCTT....................................................................................................................... | 24 | 4 | 0.75 | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | 0.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAAGCTT....................................................................................................................... | 23 | 4 | 0.75 | 0.75 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATGTCCCAAG.......................................................................................................................... | 21 | 4 | 0.75 | 0.75 | 0.50 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACG........................................................................................................................................................ | 22 | 6 | 0.67 | 0.67 | 0.17 | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - |
| ........................................................................................................................................................TGGTTGTTTATCTGAGATTCAGt............................................................... | 23 | T | 0.50 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGAAT..................................................................................................................................................... | 25 | 6 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - |
| ..............................................................................................CGTAGCATAAATATGTCCCAAGCT........................................................................................................................ | 24 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGA....................................................................................................................................................... | 23 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | 0.17 | - | - | - | - | - | - | - | - |
| ................................................................TTTGAATTTTAGATAAACAACGAATA.................................................................................................................................................... | 26 | 6 | 0.33 | 0.33 | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - |
| .............................................................................................................................................AAAAACATTATTGGTTGTTTAT........................................................................... | 22 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................GCCAGATTAAAAGACAGG.......................................................................................................................................................................................... | 18 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTAA................................................................................................ | 26 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTA................................................................................................. | 25 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAAT..................................................................................................................................................... | 23 | 7 | 0.29 | 0.29 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGA....................................................................................................................................................... | 21 | 7 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................AGCATAAATATGTCCCAAGCTT....................................................................................................................... | 22 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAAGCTTAGT.................................................................................................................... | 26 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................CGTAGCATAAATATGTCCCAAG.......................................................................................................................... | 22 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TTCGTAGCATAAATATGTCCC............................................................................................................................. | 21 | 4 | 0.25 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAAGCTc....................................................................................................................... | 23 | C | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTAGCATAAATATGTCCCAAGCTTA...................................................................................................................... | 25 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..TCCGGCATTTTTGGCCCTgaa....................................................................................................................................................................................................................... | 21 | GAA | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAAGCTcagt.................................................................................................................... | 26 | CAGT | 0.25 | 0.00 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................ATAAATATGTCCCAAtctg....................................................................................................................... | 19 | TCTG | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................CGTAGCATAAATATGTCCCAAGCTT....................................................................................................................... | 25 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................AGTTTGGGACATACTTATGCTAtt............................................................................................... | 24 | TT | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................ATTTTATTTGCTGCCTCgg.............................. | 19 | GG | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................TTGTTTATCTGAGATTCAGAAT............................................................. | 22 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................TCGTAGCATAAATATcccc.............................................................................................................................. | 19 | CCCC | 0.20 | 0.00 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................TTATTGGTTGTTTATCTGAGAa.................................................................... | 22 | A | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................TTAGATAAACAACGAAattt.................................................................................................................................................. | 20 | ATTT | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................TGCTGCCTCTGGCCACCCTACTCTCTaaaa........... | 30 | AAAA | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................ATTATTGGTTGTTTATCTtata..................................................................... | 22 | TATA | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................TTAGATAAACAACGAATAATTT................................................................................................................................................ | 22 | 6 | 0.17 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................GATTAAAAGACAGGATGCCCAGCTAGTT............................................................................................................................................................................ | 28 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAA...................................................................................................................................................... | 22 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| ......................................................................TTTTAGATAAACAACGAATA.................................................................................................................................................... | 20 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - |
| ..................................................................TGAATTTTAGATAAACAACGAAa..................................................................................................................................................... | 23 | A | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |
| .........................................................................................................................TTTGGGACATACTTATGCTAAta.............................................................................................. | 23 | TA | 0.10 | 0.00 | - | - | - | - | - | - | - | - | - | - | 0.10 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CCTCCGGCATTTTTGGCCCTTGCCTTTTAGGGTTGCCAGATTAAAAGACAGGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATCTGAGATTCAGAATTAAGCATTTTATATTTTATTTGCTGCCTCTGGCCACCCTACTCTCTTCCTAACACTCTCTC ...................................................((((........)))).......(((((....)))))(((((((.((((((((((((...)))))))))))).)))))))........................................................ ...........................................................60....................................................................................146.......................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR314796(SRX084354) Total RNA, fractionated (15-30nt). (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR095854(SRX039177) miRNA were isolated from FirstChoice Human Br. (brain) | SRR189786 | SRR189784 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189783 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR139216(SRX050633) FLASHPage purified small RNA (~15-40nt) from . (thymus) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139185(SRX050632) FLASHPage purified small RNA (~15-40nt) from . (lung) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR139200(SRX050639) FLASHPage purified small RNA (~15-40nt) from . (placenta) | SRR139219(SRX050655) FLASHPage purified small RNA (~15-40nt) from . (thymus) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR139208(SRX050635) FLASHPage purified small RNA (~15-40nt) from . (testes) | TAX577739(Rovira) total RNA. (breast) | SRR139179(SRX050638) FLASHPage purified small RNA (~15-40nt) from . (liver) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................TCGTAGCATAAATATGTCCCAA........................................................................................................................... | 22 | 4 | 0.75 | 0.75 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................ctcCTGGCCACCCTACTCT................. | 19 | ctc | 0.60 | 0.00 | - | - | - | - | 0.60 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CTTAGTTTGGGACATACTTATGCTA................................................................................................. | 25 | 7 | 0.29 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................aCGTAGCATAAATATGTCCCAA........................................................................................................................... | 22 | a | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................ctacTCAGAATTAAGCATT..................................................... | 19 | ctac | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................CGTAGCATAAATATGTCCCAA........................................................................................................................... | 21 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................tctTAGCATAAATATGTCCCAA........................................................................................................................... | 22 | tct | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - |
| ................................................................................................TAGCATAAATATGTCCCAA........................................................................................................................... | 19 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................TACTCTCTTCCTAACACTCTCT. | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................CCCTACTCTCTTCCTAACACTC.... | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................ACCCTACTCTCTTCCTAACAC...... | 21 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................GCCACCCTACTCTCTTCCTAAC........ | 22 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................AGTTTGGGACATACTTATGCTAAA............................................................................................... | 24 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - |