| (2) AGO2.ip | (8) B-CELL | (4) BRAIN | (4) BREAST | (12) CELL-LINE | (4) CERVIX | (3) HEART | (1) HELA | (2) LIVER | (3) OTHER | (11) SKIN | (1) UTERUS |
| TGCTGCTGGACAGCAGTGGCAGTCACCTCTATGTCCTGACTGCCCACCAGGTGAGGGCCATCCTGGGGCTGAAGGGGCCAGCACACGCGGCCCAAGTCTCGTGCCCATTGCCTCTCTGCTCTGCTGCCCCTCCAGGTGGACCGGATACCTGTGGCAGCCTGCCCCCAGTTCCCTGACTGTGCCAG ....................................................(((((.((...((((((.((.(((((.....((((.(((....))).))))......))))))).)))))).)).)))))..................................................... ..................................................51...............................................................................132................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR343337 | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189785 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040020(GSM532905) G699N_2. (cervix) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR343334 | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191435(GSM715545) 172genomic small RNA (size selected RNA from . (breast) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR040012(GSM532897) G648N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577453(Rovira) total RNA. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR343335 | SRR343336 | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR040016(GSM532901) G645N. (cervix) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................ATCCTGGGGCTGAAGCCG............................................................................................................ | 18 | 6.00 | 0.00 | - | 2.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGCAG............................................................................................................ | 18 | 6.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGCAGG........................................................................................................... | 19 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................CATCCTGGGGCTGAAGCAGG........................................................................................................... | 20 | 4 | 3.25 | 0.25 | - | - | - | - | 0.25 | - | - | - | 0.25 | - | - | 0.50 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.50 | 0.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................TCTCTGCTCTGCTGCCCCTCCAGAA................................................ | 25 | 3.00 | 0.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGAAG............................................................................................................ | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................CATCCTGGGGCTGAAGGCG............................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGAAGG........................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGAGGGCCATCCTGGGG..................................................................................................................... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAGCAG............................................................................................................ | 19 | 4 | 2.00 | 0.25 | 0.25 | - | - | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | - | - | - | - | - |
| ...........................................................ATCCTGGGGCTGAAGTCG............................................................................................................ | 18 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................CATCCTGGGGCTGAAGTAG............................................................................................................ | 19 | 4 | 1.50 | 0.25 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.75 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - |
| ....GCTGGACAGCAGTGGCAGT.................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................TCCTGGGGCTGAAGGAGGT.......................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................AGGTGGACCGGATACCTGTGGCAGGC.......................... | 26 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................CTCTGCTCTGCTGCCCCTCCAT.................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGCCCATTGCCTCTCTGAGT................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................TCCTGGGGCTGAAGGGGCTAT........................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGCCGG........................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGAGGGCCATCCTGGGGCTGAAGGG............................................................................................................. | 26 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................GTCACCTCTATGTCCTGACTGC.............................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................TGGGGCTGAAGGGGCCAG........................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...TGCTGGACAGCAGTGGCAGTC................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................CTCTGCTCTGCTGCCCCTC..................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................ATCCTGGGGCTGAAGCCA............................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGACGG........................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGGGGGGAG........................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................TGAGGGCCATCCTGGGGCTGAAG............................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......TGGACAGCAGTGGCAGGC................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................ATCCTGGGGCTGAAGAA............................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................TCTGCTCTGCTGCCCCTACGG.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................CATCCTGGGGCTGAAGCCG............................................................................................................ | 19 | 4 | 0.75 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - |
| .......................................................................................................CCCATTGCCTCTCTGCT................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAGT.............................................................................................................. | 17 | 4 | 0.50 | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAGACGG........................................................................................................... | 20 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAG............................................................................................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| ..........................................................CATCCTGGGGCTGAAGAAG............................................................................................................ | 19 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAA................................................................................................................ | 15 | 8 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |
| ..........................................................CATCCTGGGGCTGAAGTAGG........................................................................................................... | 20 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAGTA............................................................................................................. | 18 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - |
| ..........................................................CATCCTGGGGCTGAAGAAGG........................................................................................................... | 20 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................CCTGGGGCTGAAGGGGC........................................................................................................... | 17 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TGCTGCTGGACAGCAGTGGCAGTCACCTCTATGTCCTGACTGCCCACCAGGTGAGGGCCATCCTGGGGCTGAAGGGGCCAGCACACGCGGCCCAAGTCTCGTGCCCATTGCCTCTCTGCTCTGCTGCCCCTCCAGGTGGACCGGATACCTGTGGCAGCCTGCCCCCAGTTCCCTGACTGTGCCAG ....................................................(((((.((...((((((.((.(((((.....((((.(((....))).))))......))))))).)))))).)).)))))..................................................... ..................................................51...............................................................................132................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR343337 | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189785 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040020(GSM532905) G699N_2. (cervix) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR343334 | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191435(GSM715545) 172genomic small RNA (size selected RNA from . (breast) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR040012(GSM532897) G648N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577453(Rovira) total RNA. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR343335 | SRR343336 | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR040016(GSM532901) G645N. (cervix) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................GTGGCAGCCTGCCCCCTAG................ | 19 | 4.00 | 0.00 | - | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................TCACCTCTATGTCCTTAAG................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................GCAGCCTGCCCCCAGTTTTT............ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GCCCAAGTCTCGTGCCAAGC............................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................CTGGAGGGGCAGCAGAG.................................................. | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................CAGCAGAGCAGAGAGGC........................................................... | 17 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - |