| (2)  AGO2.ip  | (3)  B-CELL  | (3)  BRAIN  | (7)  BREAST  | (18)  CELL-LINE  | (7)  CERVIX  | (7)  HEART  | (1)  KIDNEY  | (1)  LIVER  | (3)  OTHER  | (1)  OVARY  | (1)  RRP40.ip  | (32)  SKIN  | (3)  UTERUS  | (1)  XRN.ip  | 
| CTCCAGGAGGTTTTTTTGACTTCTTGGACTTTGAAGGGTGGCTGGGTAGGAAACAGACAGGTGTGGTGGTGGGAAGCTCAGCTGTGGGAAGACGGGCCTCCACTGGGATGAAGGATGCATGTTAGGGGAACCTGCGGGCCAGGTTGGCAGGAACTTGCTGGGCCGGGCCACCAGCAGGCTCACGGTCTTGCCCCTCTCAGTGCCAGCTCAGGCCAGACCTTCTTCTCAGATGTCGACTCCACCGACGCTG ...........................................................(((.((..(((.(((.((((..((......))..)))).))).((((.(((.......))).))))....)))..)).))).............................................................................................................. ..................................................51...........................................................................................144........................................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR343334 | SRR343336 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR189785 | SRR343335 | SRR553574(SRX182780) source: Heart. (Heart)  | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin)  | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM379267(GSM379267) Small RNA from clear cell ovarian cancer tissue. (ovary)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin)  | TAX577746(Rovira) total RNA. (breast)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | SRR040037(GSM532922) G243T. (cervix)  | SRR040028(GSM532913) G026N. (cervix)  | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell)  | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell)  | SRR040025(GSM532910) G613T. (cervix)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart)  | SRR343337 | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin)  | SRR390724(GSM850203) small rna immunoprecipitated. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR207117(GSM721079) Whole cell RNA. (cell line)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin)  | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex)  | SRR553575(SRX182781) source: Kidney. (Kidney)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR553573(SRX182779) source: Cerebellum. (Cerebellum)  | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)  | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR040031(GSM532916) G013T. (cervix)  | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line)  | SRR040008(GSM532893) G727N. (cervix)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | TAX577741(Rovira) total RNA. (breast)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR040012(GSM532897) G648N. (cervix)  | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | SRR191558(GSM715668) 61genomic small RNA (size selected RNA from t. (breast)  | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR037939(GSM510477) 293cand5_rep1. (cell line)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR029131(GSM416760) MCF7. (cell line)  | SRR037944(GSM510482) 293DcrTN_cand5. (cell line)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040015(GSM532900) G623T. (cervix)  | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast)  | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast)  | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................TAGGGGAACCTGCGG................................................................................................................. | 15 | 1 | 72.00 | 72.00 | 15.00 | 17.00 | - | - | 3.00 | 2.00 | 1.00 | - | 5.00 | - | 1.00 | 1.00 | - | - | 3.00 | 3.00 | 3.00 | - | 2.00 | 2.00 | - | 2.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 2.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGA................................................................................................................ | 16 | 1 | 21.00 | 72.00 | 5.00 | - | - | - | 3.00 | - | - | 1.00 | - | 1.00 | 3.00 | - | - | - | 1.00 | - | - | 2.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGCTG.............................................................................................................. | 18 | 1 | 20.00 | 72.00 | - | - | 5.00 | - | 1.00 | 1.00 | 1.00 | - | - | 3.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 2.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGAAGG............................................................................................................. | 19 | 1 | 16.00 | 72.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGAAG.............................................................................................................. | 18 | 1 | 15.00 | 72.00 | 5.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGCTGG............................................................................................................. | 19 | 1 | 12.00 | 72.00 | - | - | - | - | - | 2.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGC................................................................................................................ | 16 | 1 | 12.00 | 72.00 | - | - | - | - | - | 1.00 | 2.00 | 4.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGCT............................................................................................................... | 17 | 1 | 9.00 | 72.00 | - | - | - | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGTTG.............................................................................................................. | 18 | 1 | 6.00 | 72.00 | - | - | - | 4.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGAA............................................................................................................... | 17 | 1 | 6.00 | 72.00 | - | - | 3.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGTT............................................................................................................... | 17 | 1 | 5.00 | 72.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGTTGG............................................................................................................. | 19 | 1 | 4.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................GTGGGAAGCTCAGCTGTG.................................................................................................................................................................... | 18 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 
| ...................................................................GGTGGGAAGCTCAGCTGTGTAAT................................................................................................................................................................ | 23 | 1 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................GACAGGTGTGGTGGTGGGCATC............................................................................................................................................................................. | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................TAGGGGAACCTGCGGCTGA............................................................................................................. | 19 | 1 | 2.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGTAGG............................................................................................................. | 19 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGAAGC............................................................................................................. | 19 | 1 | 1.00 | 72.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................GGGAAGCTCAGCTGTGTCAT................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ..........................................................................................................................TAGGGGAACCTGCGGAACG............................................................................................................. | 19 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................GTTGGCAGGAACTTGGGC.......................................................................................... | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................GTGGGAAGCTCAGCTGTGT................................................................................................................................................................... | 19 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGAAT.............................................................................................................. | 18 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................GGTGGGAAGCTCAGCTGTG.................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................................................................................................CAGGAACTTGCTGGGTAA..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................TAGGGGAACCTGCGGCTTG............................................................................................................. | 19 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGGA............................................................................................................... | 17 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................GGTGGGAAGCTCAGCTGTGT................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................................................CTCAGGCCAGACCTTCTTCT........................ | 20 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGGGGCT............................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................GTGGGAAGCTCAGCTGTGTA.................................................................................................................................................................. | 20 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGATC.............................................................................................................. | 18 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................TAGGGGAACCTGCGGTGGG............................................................................................................. | 19 | 1 | 1.00 | 72.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................GTGGGAAGCTCAGCTGCGT................................................................................................................................................................... | 19 | 3 | 0.67 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | 
| .....................................................................TGGGAAGCTCAGCTGTG.................................................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................GTGGGAAGCTCAGCTG...................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................GTGGGAAGCTCAGCTGCA.................................................................................................................................................................... | 18 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 
| ...........................................................................................................................AGGGGAACCTGCGGG................................................................................................................ | 15 | 7 | 0.14 | 0.14 | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| CTCCAGGAGGTTTTTTTGACTTCTTGGACTTTGAAGGGTGGCTGGGTAGGAAACAGACAGGTGTGGTGGTGGGAAGCTCAGCTGTGGGAAGACGGGCCTCCACTGGGATGAAGGATGCATGTTAGGGGAACCTGCGGGCCAGGTTGGCAGGAACTTGCTGGGCCGGGCCACCAGCAGGCTCACGGTCTTGCCCCTCTCAGTGCCAGCTCAGGCCAGACCTTCTTCTCAGATGTCGACTCCACCGACGCTG ...........................................................(((.((..(((.(((.((((..((......))..)))).))).((((.(((.......))).))))....)))..)).))).............................................................................................................. ..................................................51...........................................................................................144........................................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin)  | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR343334 | SRR343336 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR189785 | SRR343335 | SRR553574(SRX182780) source: Heart. (Heart)  | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin)  | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM379267(GSM379267) Small RNA from clear cell ovarian cancer tissue. (ovary)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin)  | TAX577746(Rovira) total RNA. (breast)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | SRR040037(GSM532922) G243T. (cervix)  | SRR040028(GSM532913) G026N. (cervix)  | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell)  | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell)  | SRR040025(GSM532910) G613T. (cervix)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart)  | SRR343337 | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin)  | SRR390724(GSM850203) small rna immunoprecipitated. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR207117(GSM721079) Whole cell RNA. (cell line)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin)  | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex)  | SRR553575(SRX182781) source: Kidney. (Kidney)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR553573(SRX182779) source: Cerebellum. (Cerebellum)  | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)  | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR040031(GSM532916) G013T. (cervix)  | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line)  | SRR040008(GSM532893) G727N. (cervix)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | TAX577741(Rovira) total RNA. (breast)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR040012(GSM532897) G648N. (cervix)  | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | SRR191558(GSM715668) 61genomic small RNA (size selected RNA from t. (breast)  | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR037939(GSM510477) 293cand5_rep1. (cell line)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR029131(GSM416760) MCF7. (cell line)  | SRR037944(GSM510482) 293DcrTN_cand5. (cell line)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040015(GSM532900) G623T. (cervix)  | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast)  | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast)  | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................CCGGCCCAGCAAGTTCCTGC.................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................AGGTGTGGTGGTGGGTTTC............................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................AGCTCAGGCCAGACCCCCA........................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |