| (4) AGO2.ip | (5) B-CELL | (11) BREAST | (17) CELL-LINE | (2) CERVIX | (3) HEART | (2) HELA | (4) LIVER | (3) OTHER | (24) SKIN | (1) TESTES | (2) UTERUS | (1) XRN.ip |
| TTTGAGGATGACCGGGTAGGTACTGGGCACCACCTCTCTCGCCTGCTGAGGTGGGTATCGTCCGCGGATCCTCGGGTTTCTCGCGGAGGGAGAGGAGGGGTCGCGAGTGTAGCGGCGACGGGAGGGGACCTGGCTGCCCTGGTCCAGCGGGCCCCCAGCCAGCGGACAGGGCCCGGGCACTCCGAGGCGGCCTGCCGGCGCGTGCCGGCGCTCCGGTTACTCGTTATCTGCCCCGGGCGCGGGCCAGGCC ...............................................................................................................((.((..(((...((..(((((..(((((.((((.((.(((.....))).))))))))))))))))..)))))..)).))..((((((....))))))......................................... ...........................................................................................................108..................................................................................................209....................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577744(Rovira) total RNA. (breast) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR191409(GSM715519) 19genomic small RNA (size selected RNA from t. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR189784 | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR444051(SRX128899) Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925PAZD5 | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191395(GSM715505) 25genomic small RNA (size selected RNA from t. (breast) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | SRR191624(GSM715734) 31genomic small RNA (size selected RNA from t. (breast) | SRR040024(GSM532909) G613N. (cervix) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................CGGCGACGGGAGGGGTG......................................................................................................................... | 17 | 3 | 16.00 | 1.33 | 13.00 | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................GCCGGCGCGTGCCGGCG........................................ | 17 | 1 | 10.00 | 10.00 | - | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................AGGGGTCGCGAGTGTAAACC....................................................................................................................................... | 20 | 5.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................CGGCGACGGGAGGGGTGC........................................................................................................................ | 18 | 3 | 4.00 | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................CGGCGACGGGAGGGGT.......................................................................................................................... | 16 | 3 | 3.00 | 1.33 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......GATGACCGGGTAGGTACTGG................................................................................................................................................................................................................................ | 20 | 1 | 3.00 | 3.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................CGGCGACGGGAGGGGTCCC....................................................................................................................... | 19 | 3 | 3.00 | 1.33 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................GGAGGGGACCTGGCTGGGA............................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................GGGGTCGCGAGTGTAAAC........................................................................................................................................ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................CGGCGACGGGAGGGG........................................................................................................................... | 15 | 3 | 1.33 | 1.33 | 0.67 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GGCGGCCTGCCGGCGCTTTC............................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCGACGGGAGGGGAGC........................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................ACGGGAGGGGACCTGGGGGC................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...GAGGATGACCGGGTAGGTACTG................................................................................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................TGCCGGCGCGTGCCGGCGCTCCG................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................TGCCGGCGCGTGCCGGCGCTCCGG.................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................GCCGGCGCGTGCCGGCCG....................................... | 18 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........GACCGGGTAGGTACTGGGCACCACCTCT..................................................................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GCGGAGGGAGAGGAGGGGTA.................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................GGAGGGAGAGGAGGGGTTTTG................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................CTGCTGAGGTGGGTATCGT............................................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......GATGACCGGGTAGGTACTGGGCACCACCTCCC.................................................................................................................................................................................................................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................TCTGCCCCGGGCGCGCGC...... | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................ACGGGAGGGGACCTGGGG................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................CGGCGACGGGAGGGGAGC........................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................ATCGTCCGCGGATCCTCGGG.............................................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................CGGCCTGCCGGCGCGTGCCGGCG........................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............CGGGTAGGTACTGGGCACC........................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................GGGGTCGCGAGTGTAAACC....................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................CGCCTGCTGAGGTGGGA.................................................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............GTAGGTACTGGGCACCACCTCTCTCGC................................................................................................................................................................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................CGGCGACGGGAGGGGTGCC....................................................................................................................... | 19 | 3 | 1.00 | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....AGGATGACCGGGTAGGTACTGG................................................................................................................................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................CGGCGACGGGAGGGGGGG........................................................................................................................ | 18 | 3 | 1.00 | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................ACCTCTCTCGCCTGCTGAGGTG..................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................CTCGCGGAGGGAGAGGAGGA....................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........CCGGGTAGGTACTGGG............................................................................................................................................................................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GCGGAGGGAGAGGAGGGG...................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................AGCGGGCCCCCAGCC.......................................................................................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TTTGAGGATGACCGGGTAGGTACTGGGCACCACCTCTCTCGCCTGCTGAGGTGGGTATCGTCCGCGGATCCTCGGGTTTCTCGCGGAGGGAGAGGAGGGGTCGCGAGTGTAGCGGCGACGGGAGGGGACCTGGCTGCCCTGGTCCAGCGGGCCCCCAGCCAGCGGACAGGGCCCGGGCACTCCGAGGCGGCCTGCCGGCGCGTGCCGGCGCTCCGGTTACTCGTTATCTGCCCCGGGCGCGGGCCAGGCC ...............................................................................................................((.((..(((...((..(((((..(((((.((((.((.(((.....))).))))))))))))))))..)))))..)).))..((((((....))))))......................................... ...........................................................................................................108..................................................................................................209....................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577744(Rovira) total RNA. (breast) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR191409(GSM715519) 19genomic small RNA (size selected RNA from t. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR189784 | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR444051(SRX128899) Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925PAZD5 | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191395(GSM715505) 25genomic small RNA (size selected RNA from t. (breast) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | SRR191624(GSM715734) 31genomic small RNA (size selected RNA from t. (breast) | SRR040024(GSM532909) G613N. (cervix) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................................................................GCCGGCGCGTGCCGGCG........................................ | 17 | 7.00 | 0.00 | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................CCCAGCCAGCGGACAGC................................................................................ | 17 | 2.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................AGGCCGCCTCGGAGTGCCCG......................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................GCCGGCGCGTGCCGGCGCG...................................... | 19 | 1 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................CGCCCGGGGCAGATAACG........... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................CCGCGGACGATACCC....................................................................................................................................................................................... | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................CCCCGGGCGCGGGCCTTT.. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................GGGGCAGATAACGAGTAACCG................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................GCCGGCGCGTGCCGGCGCGG..................................... | 20 | 1 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................GGGTATCGTCCGCGGATCCCT................................................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................ATCCGCGGACGATACCC..................................................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................CCCCTCCTCTCCCTC...................................................................................................................................................... | 15 | 0 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GGCGGCCTGCCGGCGCCCC.............................................. | 19 | 0.88 | 0.00 | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | 0.12 | 0.12 | - | 0.12 | 0.12 | 0.12 | - | - | - | - | - | |
| .........................................................................................................................................................................................GGCGGCCTGCCGGCGCCC............................................... | 18 | 0.88 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.12 | 0.12 | - | - | - | - | - | - | - | 0.12 | 0.12 | 0.12 | - | |
| .........................................................................................................................................................................................CGCCGGCAGGCCGCC.................................................. | 15 | 8 | 0.38 | 0.38 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | 0.12 | - | - | - | 0.12 |
| ............................................................................................................................................GGGGCCCGCTGGACC............................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |