| (4) B-CELL | (1) BRAIN | (26) BREAST | (4) CELL-LINE | (1) CERVIX | (6) HEART | (13) LIVER | (4) OTHER | (9) SKIN | (4) UTERUS |
| ACTTCTACAAGAATATTACAAGATATTTATGGAAAAGATGCCTCCTGATTGTAAGTATGTGAGTTAGAGAAGACAGCAATAATAGCTTCTTGATTATAAATCTTTAGAAGAGGTCAGACATAGAGGTCAGTGGACTACAGAAGCAGGGGTAGGGATGTGAGAGTGATTTTGAAATTATCTGATCCAAAAAGACTGATTGCCAAGGTAGCATGGCCAACACCTGCATCATTCTCTTGATTGCCTTCTTGAA ..........................................................................................................................(((((((......((((...((....)).....))))....)))))))................................................................................ .........................................................................................................................122..................................................175......................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR189787 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | TAX577580(Rovira) total RNA. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577588(Rovira) total RNA. (breast) | SRR189782 | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577739(Rovira) total RNA. (breast) | TAX577742(Rovira) total RNA. (breast) | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR189784 | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR040010(GSM532895) G529N. (cervix) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR191433(GSM715543) 170genomic small RNA (size selected RNA from . (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR191462(GSM715572) 1genomic small RNA (size selected RNA from to. (breast) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR191516(GSM715626) 66genomic small RNA (size selected RNA from t. (breast) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR191454(GSM715564) 180genomic small RNA (size selected RNA from . (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR191449(GSM715559) 144genomic small RNA (size selected RNA from . (breast) | TAX577740(Rovira) total RNA. (breast) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR191626(GSM715736) 36genomic small RNA (size selected RNA from t. (breast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | TAX577590(Rovira) total RNA. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191456(GSM715566) 182genomic small RNA (size selected RNA from . (breast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191455(GSM715565) 181genomic small RNA (size selected RNA from . (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577745(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR343337 | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................TCAGTGGACTACAGAACT.......................................................................................................... | 18 | 62.00 | 0.00 | 13.00 | 3.00 | - | 7.00 | 8.00 | 1.00 | 7.00 | - | 5.00 | - | 6.00 | - | 1.00 | - | - | 3.00 | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACTTT........................................................................................................ | 20 | 59.00 | 0.00 | 2.00 | 4.00 | - | 2.00 | 3.00 | - | - | - | 1.00 | - | - | - | 1.00 | 2.00 | 3.00 | 1.00 | 2.00 | 1.00 | 3.00 | 3.00 | - | 2.00 | - | 2.00 | 2.00 | 2.00 | - | 1.00 | 1.00 | 2.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAC........................................................................................................... | 17 | 25.00 | 0.00 | - | - | - | - | - | 9.00 | - | 7.00 | - | 3.00 | - | 3.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGCTTGT...................................................................................................... | 22 | 13.00 | 0.00 | - | - | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACTT......................................................................................................... | 19 | 12.00 | 0.00 | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAT........................................................................................................... | 17 | 4.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATT.......................................................................................................... | 18 | 4.00 | 0.00 | - | 1.00 | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................AGTGGACTACAGAAGTTT........................................................................................................ | 18 | 3.00 | 0.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATTTT........................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACGG......................................................................................................... | 19 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................TGCCTCCTGATTGTAAGTA................................................................................................................................................................................................. | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCAGTGGACTACAGAAATTT........................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACGAC........................................................................................................ | 20 | 2.00 | 0.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGTTTG....................................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................AGTGGACTACAGAAGTTTG....................................................................................................... | 19 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACGGT........................................................................................................ | 20 | 2.00 | 0.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATGAC........................................................................................................ | 20 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAAGGC........................................................................................................ | 20 | 2.00 | 0.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATGGC........................................................................................................ | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................CAAGATATTTATGGAAAAGATGCCTCCTGA.......................................................................................................................................................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCAGTGGACTACAGAACGTT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGT.......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATGGT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAAT.......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................AAGATATTTATGGAAAAGA.................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCAGTGGACTACAGAAGCTCGT...................................................................................................... | 22 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGGAC........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGCCTGT...................................................................................................... | 22 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACGGC........................................................................................................ | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACTTG........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAAA.......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGACT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGTT......................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACGGA........................................................................................................ | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAATTC........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGAGT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................AGGGATGTGAGAGTGATGAAC............................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGAC......................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAACC......................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACCGG........................................................................................................ | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACG.......................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACTGT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGCTGGT...................................................................................................... | 22 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAACAGG........................................................................................................ | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAATTT......................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGAAGGAT........................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TCAGTGGACTACAGA............................................................................................................. | 15 | 6 | 0.50 | 0.50 | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | 0.17 |
| ..............................................................................................................................TCAGTGGACTACAGATTGT......................................................................................................... | 19 | 6 | 0.17 | 0.50 | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCAGTGGACTACAGAGCTT......................................................................................................... | 19 | 6 | 0.17 | 0.50 | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ACTTCTACAAGAATATTACAAGATATTTATGGAAAAGATGCCTCCTGATTGTAAGTATGTGAGTTAGAGAAGACAGCAATAATAGCTTCTTGATTATAAATCTTTAGAAGAGGTCAGACATAGAGGTCAGTGGACTACAGAAGCAGGGGTAGGGATGTGAGAGTGATTTTGAAATTATCTGATCCAAAAAGACTGATTGCCAAGGTAGCATGGCCAACACCTGCATCATTCTCTTGATTGCCTTCTTGAA ..........................................................................................................................(((((((......((((...((....)).....))))....)))))))................................................................................ .........................................................................................................................122..................................................175......................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR189787 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | TAX577580(Rovira) total RNA. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577588(Rovira) total RNA. (breast) | SRR189782 | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577739(Rovira) total RNA. (breast) | TAX577742(Rovira) total RNA. (breast) | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR189784 | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR040010(GSM532895) G529N. (cervix) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR191433(GSM715543) 170genomic small RNA (size selected RNA from . (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR191462(GSM715572) 1genomic small RNA (size selected RNA from to. (breast) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR191516(GSM715626) 66genomic small RNA (size selected RNA from t. (breast) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR191454(GSM715564) 180genomic small RNA (size selected RNA from . (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR191606(GSM715716) 84genomic small RNA (size selected RNA from t. (breast) | SRR191449(GSM715559) 144genomic small RNA (size selected RNA from . (breast) | TAX577740(Rovira) total RNA. (breast) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR191626(GSM715736) 36genomic small RNA (size selected RNA from t. (breast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | TAX577590(Rovira) total RNA. (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191456(GSM715566) 182genomic small RNA (size selected RNA from . (breast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191455(GSM715565) 181genomic small RNA (size selected RNA from . (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577745(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR343337 | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................GTGGACTACAGAAGCCGG....................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| .................................................................................................................................GTGGACTACAGAAGCCGGT...................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................TCACATCCCTACCCCT.......................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |