| (1) AGO2.ip | (8) B-CELL | (4) BREAST | (14) CELL-LINE | (1) CERVIX | (1) HEART | (1) HELA | (1) KIDNEY | (13) LIVER | (1) OTHER | (8) SKIN | (1) TESTES | (4) UTERUS |
| GATATGGACACTATAGATGTTTCCAATCTAAATAGGCAGTTTTTATTTAGGTAAGTTTTAATATCTTAGCGGTTTTCTTTTTTTAAGCTCTGATAATCATTTGAACTTGTACATTGCAGTTTAATAATTTTTAAAAATGACTTGAGAGGATAATACTAATTTTATTTTAAAAAACAAAAACTACCATTCCCATTGTAGGTAAAGTTTTGTAAGAAAATTTTGGGCATCTTGGTGATAGTAGTTATGTAAA .......................................................................................((((.....((((((((((.(((.....)))))))))............))))....))))...................................................................................................... ...................................................................................84.......................................................................157........................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR343335 | SRR343334 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189785 | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR189783 | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR343336 | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR343337 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR189782 | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR029124(GSM416753) HeLa. (hela) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040019(GSM532904) G701T. (cervix) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR038856(GSM458539) D11. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................AAATGACTTGAGAGGTGTA................................................................................................. | 19 | 271.00 | 0.00 | 110.00 | 12.00 | 11.00 | 9.00 | 14.00 | 14.00 | 12.00 | - | 9.00 | 8.00 | 8.00 | 1.00 | 6.00 | 6.00 | - | 2.00 | - | 5.00 | 4.00 | 4.00 | 3.00 | 4.00 | 2.00 | 3.00 | 3.00 | - | 3.00 | 2.00 | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | 2.00 | 2.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | |
| ......................................................................................................................................AAATGACTTGAGAGGTG................................................................................................... | 17 | 54.00 | 0.00 | - | 4.00 | 4.00 | 6.00 | - | - | - | 11.00 | - | - | - | 5.00 | - | - | 5.00 | 1.00 | 5.00 | - | - | - | 1.00 | - | - | - | - | 3.00 | - | 1.00 | - | 1.00 | 2.00 | 1.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGTGT.................................................................................................. | 18 | 10.00 | 0.00 | 1.00 | 1.00 | - | - | - | - | - | - | 2.00 | - | - | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGGGTA................................................................................................. | 19 | 3.00 | 0.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGCGTA................................................................................................. | 19 | 3.00 | 0.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................TCTGATAATCATTTGAACTT.............................................................................................................................................. | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AAATGACTTGAGAGGTTTA................................................................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGAGTA................................................................................................. | 19 | 2.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGTATA................................................................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................TCTTGGTGATAGTAGCAA...... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | |
| .................................................................................................................................................................................................................................ATCTTGGTGATAGTAGCAAA..... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| .............................................................................................................................AATTTTTAAAAATGACTTGAGA....................................................................................................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................AAATGACTTGAGAGGTGCA................................................................................................. | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................TCTTGGTGATAGTAGCA....... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................AGTTTTAATATCTTAGCGGTTTTCTTTC......................................................................................................................................................................... | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................GTTTTCTTTTTTTAAGGTAC............................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | |
| ..................................................................................................................................................................................................................................TCTTGGTGATAGTAGC........ | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGCG................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................CTAATTTTATTTTAACCAG............................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .ATATGGACACTATAGATG....................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................ATCTTGGTGATAGTAGCA....... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGCGCA................................................................................................. | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..TATGGACACTATAGATGT...................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ....TGGACACTATAGATGTTT.................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................GGTTTTCTTTTTTTAAGCTTTT.............................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................TCTTGGTGATAGTAGCAAA..... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGTGTG................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................AAATGACTTGAGAGGTGTC................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................TAGGCAGTTTTTATTTA......................................................................................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...ATGGACACTATAGATG....................................................................................................................................................................................................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................AATGACTTGAGAGGATAA................................................................................................. | 18 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GATATGGACACTATAGATGTTTCCAATCTAAATAGGCAGTTTTTATTTAGGTAAGTTTTAATATCTTAGCGGTTTTCTTTTTTTAAGCTCTGATAATCATTTGAACTTGTACATTGCAGTTTAATAATTTTTAAAAATGACTTGAGAGGATAATACTAATTTTATTTTAAAAAACAAAAACTACCATTCCCATTGTAGGTAAAGTTTTGTAAGAAAATTTTGGGCATCTTGGTGATAGTAGTTATGTAAA .......................................................................................((((.....((((((((((.(((.....)))))))))............))))....))))...................................................................................................... ...................................................................................84.......................................................................157........................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR343335 | SRR343334 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189785 | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR189783 | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR343336 | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR343337 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR189782 | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR029124(GSM416753) HeLa. (hela) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040019(GSM532904) G701T. (cervix) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR038856(GSM458539) D11. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................................................................................AAAAAACAAAAACTACCATTC............................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................AAAATTTTGGGCATCGCA................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |