| (1) AGO2.ip | (1) AGO3.ip | (2) B-CELL | (2) BRAIN | (4) BREAST | (14) CELL-LINE | (1) CERVIX | (1) FIBROBLAST | (2) HEART | (1) HELA | (1) KIDNEY | (6) LIVER | (1) OTHER | (12) SKIN | (1) XRN.ip |
| CTCCCCTTCCAGAAAAATGCCTCAGCTCTTCCGGCCTGAAGGAATGGCCTCCTCCCGGGCCCCATGATTCTTTCCTGTGTGGGCCCTCCTGGCCCTGGCCTCTGGGCTGAGGCTTGCTAGGGACTCGGGGTGGCTCTAAGGGGCAGGGATAGGGCTGGGGAGCGCCGGCCTGTGGCCCTGACCAGCCCCTTCTCGTGCAGGTTCCACCCCGATGCAGGTGGTCACGTGCTTGACGCGGGACAGCTACCTG ..............................................................................................................................................(((((((..(((((((..((.((((.....)))).))..)))))))..)))).))).................................................... ........................................................................................................................................137............................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR189782 | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | TAX577746(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR191500(GSM715610) 7genomic small RNA (size selected RNA from to. (breast) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR038854(GSM458537) MM653. (cell line) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR038860(GSM458543) MM426. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTGCAGT................................................. | 25 | 1 | 17.00 | 7.00 | 1.00 | - | 8.00 | 4.00 | - | - | - | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAGCAAT.................................................................................... | 25 | 1 | 9.00 | 4.00 | - | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAG........................................................................................ | 21 | 1 | 7.00 | 7.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTGCAG.................................................. | 24 | 1 | 7.00 | 7.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................CTGACCAGCCCCTTCTCGTGCAGT................................................. | 24 | 1 | 6.00 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACCAGCCCCTTCTCGTGCAGT................................................. | 23 | 1 | 6.00 | 1.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAGC....................................................................................... | 22 | 1 | 4.00 | 4.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAGCAT..................................................................................... | 24 | 1 | 4.00 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTGCAT.................................................. | 24 | 1 | 4.00 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACCAGCCCCTTCTCGTGCAGA................................................. | 23 | 1 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTGC.................................................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................CCCTGACCAGCCCCTTCTCGTGC.................................................... | 23 | 1 | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................AGGGACTCGGGGTGGCTCTAAGGGGCA......................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GCAGGGATAGGGCTGGGGAG........................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAGCGGCT................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................GAAGGAATGGCCTCCTCCCG................................................................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..................................................................................................................................................................................................................GATGCAGGTGGTCACGTGC..................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................TGACGCGGGACAGCTACCAAG | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCG....................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................CCCTGACCAGCCCCTTCTCGTT..................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................CAGGTGGTCACGTGCTTGACGC.............. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAAA....................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTGCA................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACCAGCCCCTTCTCGTGCAG.................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CCGGCCTGTGGCCCTGACCAGCCCC............................................................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................GGGCAGGGATAGGGCTGGGGAGTATT.................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................GCAGGGATAGGGCTGTCGG......................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ......................................................................................................................AGGGACTCGGGGTGGC.................................................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................GGGCTGGGGAGCGCCGCGG................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................CGGCCTGTGGCCCTGGGGC.................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| .....................................................................................................................................................................CGGCCTGTGGCCCTGACCAGCCCC............................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................GACGCGGGACAGCTACCTTACG | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................TGGGGAGCGCCGGCCTGTGGCCCTGACCAGCCC.............................................................. | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................TTCCGGCCTGAAGGACCA............................................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................CTGACCAGCCCCTTCTCGTGCAG.................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................CGGCCTGTGGCCCTGACCAGC................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCTGACCAGCCCCTTCTCGTG..................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGCAGGGATAGGGCTGGAAAT........................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGCAGGGATAGGGCTGGGGAGTAAA.................................................................................... | 25 | 1 | 1.00 | 7.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................TCTAAGGGGCAGGGATAGGGCTGG............................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............AAAAATGCCTCAGCTCTT............................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 |
| ..........................................................................................................................................................CTGGGGAGCGCCGGCCTGTGG........................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................GGAATGGCCTCCTCCCGGGC.............................................................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................CCCTGACCAGCCCCTTC.......................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................TCCGGCCTGAAGGAACA............................................................................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ..............................................................................................................................................GCAGGGATAGGGCTGTCT.......................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGCAGGGATAGGGCTGGTAGA........................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................GGATAGGGCTGGGGAG........................................................................................ | 16 | 4 | 0.25 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CTCCCCTTCCAGAAAAATGCCTCAGCTCTTCCGGCCTGAAGGAATGGCCTCCTCCCGGGCCCCATGATTCTTTCCTGTGTGGGCCCTCCTGGCCCTGGCCTCTGGGCTGAGGCTTGCTAGGGACTCGGGGTGGCTCTAAGGGGCAGGGATAGGGCTGGGGAGCGCCGGCCTGTGGCCCTGACCAGCCCCTTCTCGTGCAGGTTCCACCCCGATGCAGGTGGTCACGTGCTTGACGCGGGACAGCTACCTG ..............................................................................................................................................(((((((..(((((((..((.((((.....)))).))..)))))))..)))).))).................................................... ........................................................................................................................................137............................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR189782 | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | TAX577746(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR191500(GSM715610) 7genomic small RNA (size selected RNA from to. (breast) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR038854(GSM458537) MM653. (cell line) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR038860(GSM458543) MM426. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................................................................GCCCTGACCAGCCCCTGG.......................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGGTTCCACCCCGATGCCA................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................ACCAGCCCCTTCTCGGG..................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................GCCACCCCGAGTCCCTAGCAAGCCT.................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |