| (1) AGO1.ip | (3) AGO2.ip | (3) B-CELL | (5) BRAIN | (4) BREAST | (20) CELL-LINE | (3) HEART | (2) HELA | (1) KIDNEY | (8) LIVER | (3) OTHER | (7) SKIN | (1) UTERUS | (1) XRN.ip |
| GCAGCGGCCTGAGTTCCACGCCCTGAGGGCAGGCTTTGCCCTGGATGAGGGTGAGCAGGTTGGCAAGCCAATGAGCAGCCAGGCAGGGAGTAGGAGGCTGCTAGTGGGGACTGAGCTGCTCCACCCTCTGAACCCCCTTTCCCTCCTCAGGCATAGCCAATCCCACTGATGCCTTCACTGTCTTTTATAGTGAGCGGAGT .....................................................................................(((((.(((.((....(((.(((....(((...)))..))).)))...))))))))))......................................................... .....................................................................................86..............................................................150................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | TAX577740(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR189786 | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR207110(GSM721072) Nuclear RNA. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038861(GSM458544) MM466. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR038860(GSM458543) MM426. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577589(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTGA...................................................................................... | 24 | 1 | 10.00 | 10.00 | - | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCTGAACCCCCTTTCCCTCCTATC.................................................. | 24 | 7.00 | 0.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................TAGGAGGCTGCTAGTGGGG........................................................................................... | 19 | 1 | 5.00 | 5.00 | - | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTGT...................................................................................... | 24 | 1 | 5.00 | 2.00 | - | - | 2.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGAC......................................................................................... | 21 | 1 | 4.00 | 4.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................AGGCAGGGAGTAGGAGGCTGC................................................................................................... | 21 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCTGAACCCCCTTTCCCTCC...................................................... | 20 | 1 | 4.00 | 4.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGG............................................................................................ | 18 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TCTGAACCCCCTTTCCCTCCTCT................................................... | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTG....................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................AGTAGGAGGCTGCTAGTGGGGACT........................................................................................ | 24 | 1 | 2.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GCAGGGAGTAGGAGGCTGC................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTGTT..................................................................................... | 25 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGAA........................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGAA......................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................TAGCCAATCCCACTGATGTTGC......................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........AGTTCCACGCCCTGAGGGCAGGCTTT................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GGCAGGGAGTAGGAGGCTGA................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GTAGGAGGCTGCTAGTGGGGACTGT...................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................TAGCCAATCCCACTGAAA............................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACA........................................................................................ | 22 | 1 | 1.00 | 4.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTGAAA.................................................................................... | 26 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACT........................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGAAA.......................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACTGAT..................................................................................... | 25 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................TGAGCAGCCAGGCAGGGGCGT............................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................GGCAGGGAGTAGGAGGCT..................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................AGGCAGGGAGTAGGAGGCT..................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................CTGAACCCCCTTTCCCTCCTCTA.................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................CTGAACCCCCTTTCCGGG....................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................GGGAGTAGGAGGCTGATG................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ...............................................AGGGTGAGCAGGTTGTGG....................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................CCAGGCAGGGAGTAGGAGGCTG.................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................TAGCCAATCCCACTGATGTTGA......................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................TAGGAGGCTGCTAGTGGGGACCGA...................................................................................... | 24 | 1 | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TAGGAGGCTGCTAGTGG............................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................AGGGAGTAGGAGGCTGC................................................................................................... | 17 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - |
| ...................................................................................CAGGGAGTAGGAGGCTGC................................................................................................... | 18 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| .......................................................................................................GTGGGGACTGAGCTGC................................................................................. | 16 | 2 | 0.50 | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCAGCGGCCTGAGTTCCACGCCCTGAGGGCAGGCTTTGCCCTGGATGAGGGTGAGCAGGTTGGCAAGCCAATGAGCAGCCAGGCAGGGAGTAGGAGGCTGCTAGTGGGGACTGAGCTGCTCCACCCTCTGAACCCCCTTTCCCTCCTCAGGCATAGCCAATCCCACTGATGCCTTCACTGTCTTTTATAGTGAGCGGAGT .....................................................................................(((((.(((.((....(((.(((....(((...)))..))).)))...))))))))))......................................................... .....................................................................................86..............................................................150................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | TAX577740(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR189786 | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR207110(GSM721072) Nuclear RNA. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038861(GSM458544) MM466. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR038860(GSM458543) MM426. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577589(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................CAATGAGCAGCCAGGTTA.................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| .......CAGGGCGTGGAACTCAGG............................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................CTGCTCACCCTCATCCAGGGC.............................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................GCAAGCCAATGAGCATT......................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................GCTGCTCCACCCTCTGAACCCCCTTC............................................................ | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......AGGGCGTGGAACTCAGGC................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..........GAGTTCCACGCCCTGATG............................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........TGAGTTCCACGCCCTTC.............................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................CATAGCCAATCCCACTTTG.............................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................ATCCCACTGATGCCTTCACTGTCTCGG.............. | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........GAGTTCCACGCCCTGTG............................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................GCTGCTCCACCCTCTGAACCCCCTCC............................................................ | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................CCTCCTACTCCCTGCCT....................................................................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| ................................................................................................................................................................GAAGGCATCAGTGGGA........................ | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |