| (10) B-CELL | (5) BREAST | (31) CELL-LINE | (1) CERVIX | (2) FIBROBLAST | (2) HEART | (2) HELA | (6) LIVER | (1) OTHER | (2) RRP40.ip | (6) SKIN | (4) UTERUS |
| TCTTTTATTGATTAAAAGACTTACTCTTTCAAGACTGAAGTATCCCTTTAGTAAATCTCCAGATGATGTATATGACTAGCTGATGTGCATAATTATCTATGCTGGAGCCTTGTAGTTAAGACTCATGAGTTGTGATGTGTTTAACAGGTGCATTTCATTTTTAGTTCTGAGTGTAACACAATCTTGCTTTCCATCCTTAGGCTCACATTGTCCTTGAAGTTCCTCCATATCATAACCCAGCAGTTACAGC ........................................................((..((((((.........(((((.((((........))))...))))).(((((((....((.((((((.....)))).)).))..))))).))...))))))..))...................................................................................... ..................................................51.................................................................................................................166.................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR207118(GSM721080) RRP40 knockdown. (RRP40 cell line) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR038860(GSM458543) MM426. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR189782 | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR038862(GSM458545) MM472. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR040016(GSM532901) G645N. (cervix) | DRR001484(DRX001038) "Hela long nuclear cell fraction, control". (hela) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR029128(GSM416757) H520. (cell line) | SRR037931(GSM510469) 293GFP. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | TAX577590(Rovira) total RNA. (breast) | SRR038861(GSM458544) MM466. (cell line) | SRR038859(GSM458542) MM386. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR038857(GSM458540) D20. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR038852(GSM458535) QF1160MB. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................TCCAGATGATGTATATGACTAGCTGATG..................................................................................................................................................................... | 28 | 1 | 158.00 | 158.00 | - | 24.00 | 34.00 | 23.00 | - | 15.00 | 8.00 | 9.00 | - | 6.00 | 1.00 | - | - | 3.00 | 5.00 | - | - | 1.00 | 3.00 | - | 3.00 | - | 2.00 | - | - | - | - | - | 2.00 | - | 2.00 | - | - | 2.00 | 2.00 | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 |
| .........................................................TCCAGATGATGTATATGACTAGCTG........................................................................................................................................................................ | 25 | 1 | 63.00 | 63.00 | 44.00 | - | - | - | 16.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CCAGATGATGTATATGACTAGCTGATG..................................................................................................................................................................... | 27 | 1 | 52.00 | 52.00 | - | 13.00 | 4.00 | 7.00 | - | 1.00 | 4.00 | - | 7.00 | 1.00 | 1.00 | - | - | 2.00 | - | - | - | 2.00 | - | - | - | 1.00 | - | - | - | - | 2.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CCAGATGATGTATATGACTAGCTG........................................................................................................................................................................ | 24 | 1 | 14.00 | 14.00 | 6.00 | - | - | - | 4.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCT......................................................................................................................................................................... | 24 | 1 | 12.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | 3.00 | - | - | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGATGT.................................................................................................................................................................... | 29 | 1 | 10.00 | 10.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - |
| ...............................................................TGATGTATATGACTAGCTGATG..................................................................................................................................................................... | 22 | 1 | 8.00 | 8.00 | - | - | - | - | - | - | - | - | - | - | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CCAGATGATGTATATGACTAGCT......................................................................................................................................................................... | 23 | 1 | 6.00 | 6.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTA............................................................................................................................................................................ | 21 | 1 | 5.00 | 5.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGAT...................................................................................................................................................................... | 27 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGATT..................................................................................................................................................................... | 28 | 1 | 3.00 | 4.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................CAGATGATGTATATGACTAGCTGATG..................................................................................................................................................................... | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGC.......................................................................................................................................................................... | 23 | 1 | 2.00 | 2.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CCAGATGATGTATATGACTAGCTGA....................................................................................................................................................................... | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................TGATGTATATGACTAGCTGATGT.................................................................................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTT........................................................................................................................................................................ | 25 | 1 | 2.00 | 12.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGCTCACATTGTCCCTG.................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................CAGATGATGTATATGACTAGCT......................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................TTCCTCCATATCATAACCCAGCAGTTACA.. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................ATTGTCCTTGAAGTTGC........................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................TCCAGATGATGTATATGACTAGCTGCTG..................................................................................................................................................................... | 28 | 1 | 1.00 | 63.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTGATG......................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................CAGATGATGTATATGACTAGCTG........................................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGA....................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTATCTG........................................................................................................................................................................ | 25 | 1 | 1.00 | 5.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGATG........................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCCG........................................................................................................................................................................ | 25 | 1 | 1.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGAAG..................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTGATTT.................................................................................................................................................................... | 29 | 1 | 1.00 | 4.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CCAGATGATGTATATGACTAGCTGATGT.................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................ATATCATAACCCAGCAGTTACA.. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAGCTAATG..................................................................................................................................................................... | 28 | 1 | 1.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................CATTTCATTTTTAGTTATC................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................TAACACAATCTTGCTTTCCATCCTTAG.................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| .........................................................TCCAGATGATGTATATGACTAG........................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TCTTTTATTGATTAAAAGACTTACTCTTTCAAGACTGAAGTATCCCTTTAGTAAATCTCCAGATGATGTATATGACTAGCTGATGTGCATAATTATCTATGCTGGAGCCTTGTAGTTAAGACTCATGAGTTGTGATGTGTTTAACAGGTGCATTTCATTTTTAGTTCTGAGTGTAACACAATCTTGCTTTCCATCCTTAGGCTCACATTGTCCTTGAAGTTCCTCCATATCATAACCCAGCAGTTACAGC ........................................................((..((((((.........(((((.((((........))))...))))).(((((((....((.((((((.....)))).)).))..))))).))...))))))..))...................................................................................... ..................................................51.................................................................................................................166.................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR207118(GSM721080) RRP40 knockdown. (RRP40 cell line) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR038860(GSM458543) MM426. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR189782 | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR038862(GSM458545) MM472. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR040016(GSM532901) G645N. (cervix) | DRR001484(DRX001038) "Hela long nuclear cell fraction, control". (hela) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR029128(GSM416757) H520. (cell line) | SRR037931(GSM510469) 293GFP. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | TAX577590(Rovira) total RNA. (breast) | SRR038861(GSM458544) MM466. (cell line) | SRR038859(GSM458542) MM386. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR038857(GSM458540) D20. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR038852(GSM458535) QF1160MB. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................................................................AGGCTCACATTGTCCTTGAAGCTG............................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................AGTTCTGAGTGTAACACTG..................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ....................................................................................................................................................................TTCTGAGTGTAACACGGTC................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................GTCCTTGAAGTTCCTTCTC...................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................GTTTAACAGGTGCATGTAT............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |