| (1) AGO1.ip OTHER.mut | (1) AGO2.ip | (1) B-CELL | (2) BRAIN | (14) BREAST | (16) CELL-LINE | (7) CERVIX | (3) HEART | (2) HELA | (11) LIVER | (4) OTHER | (1) RRP40.ip | (12) SKIN | (1) TESTES | (4) UTERUS |
| CACGGTTCTGCAGGCTGTACAGGAAGTGTAGTGGCTTCTCCTTCTGGGGAGAGTCAGGAAAGTTAGGATCATGGCAGAAGACAAAGGGGAGCAGGTGCGTCACATGGCCAGACCAGGAGCCACAGGAAGCAGGGAAGGTCTACACACTGTTAGGCAACTAGATCTTATGAGAACTCACACACTGTCATGAGAACAGCACCAGGAGTTTGTTCTAAACCATTCATGAAAGACCCACCCCATGTCCCAGTCATCTCCCACCAGGTCCCACCTTCACAATTGAGGATTATAATACAACATGAGATTTGGGGCAGGACACAGATCCAAACCACATCAGATACACATTGTGAAATGCTCATCATGGCCAAGGTAATTTGTATATCCATTTTCTCATGGAGCTACCATTTTATTT ..................................................................................................................................................................................................................................................(((((..(((((((....))......(((((....)))))...............))))))))))...................................................................................................... ............................................................................................................................................................................................................................................237...................................................................307.................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040024(GSM532909) G613N. (cervix) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR191459(GSM715569) 32genomic small RNA (size selected RNA from t. (breast) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189787 | SRR189786 | SRR191409(GSM715519) 19genomic small RNA (size selected RNA from t. (breast) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR040018(GSM532903) G701N. (cervix) | SRR029124(GSM416753) HeLa. (hela) | SRR037936(GSM510474) 293cand1. (cell line) | TAX577580(Rovira) total RNA. (breast) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191469(GSM715579) 117genomic small RNA (size selected RNA from . (breast) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR191421(GSM715531) 122genomic small RNA (size selected RNA from . (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040029(GSM532914) G026T. (cervix) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR191416(GSM715526) 34genomic small RNA (size selected RNA from t. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR040014(GSM532899) G623N. (cervix) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR191474(GSM715584) 16genomic small RNA (size selected RNA from t. (breast) | SRR191422(GSM715532) 129genomic small RNA (size selected RNA from . (breast) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM532879(GSM532879) G659N. (cervix) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | GSM532887(GSM532887) G761N. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | GSM532886(GSM532886) G850T. (cervix) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR553576(SRX182782) source: Testis. (testes) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAAG.......................................................................................................... | 20 | 86.00 | 0.00 | 39.00 | 2.00 | 2.00 | 3.00 | 1.00 | 2.00 | 1.00 | 3.00 | 1.00 | - | - | 3.00 | - | 1.00 | 1.00 | - | - | 2.00 | 2.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAA........................................................................................................... | 19 | 34.00 | 0.00 | 2.00 | 4.00 | - | 2.00 | 4.00 | 3.00 | 4.00 | - | - | 2.00 | 3.00 | - | - | 1.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ....................................................................................................................................................................................................................................................................................................................................................................................TGTATATCCATTTTCGGA................... | 18 | 4.00 | 0.00 | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATCAG.......................................................................................................... | 20 | 3.00 | 0.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAC........................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................................................................................TATAATACAACATGATAAG.......................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAAA.......................................................................................................... | 20 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAAT.......................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATTA........................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......CTGCAGGCTGTACAGGAAGGGC............................................................................................................................................................................................................................................................................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................ACAGGAAGTGTAGTGGTA..................................................................................................................................................................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ......TCTGCAGGCTGTACAGGAAGGAC............................................................................................................................................................................................................................................................................................................................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ......TCTGCAGGCTGTACAGGAAGGCG............................................................................................................................................................................................................................................................................................................................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATTAT.......................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGCTCT........................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATTAG.......................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................TCCCAGTCATCTCCCGAA...................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGATAG........................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................................................GTCCCACCTTCACAATCA.................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................CACCCCATGTCCCAGTCATCTCCC......................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGTTAT........................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGCTGA........................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGAGAAGA......................................................................................................... | 21 | 4 | 0.50 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| .....................................................TCAGGAAAGTTAGGATCATGGCAGAAGACAAAGGGGA............................................................................................................................................................................................................................................................................................................................... | 37 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGAGA............................................................................................................ | 18 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGAGAAGCT........................................................................................................ | 22 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGAGAAAT......................................................................................................... | 21 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| ...........................................................................................................................................................................................................................................................................................TTATAATACAACATGAGAAGC......................................................................................................... | 21 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................TACACACTGTTAGGC.............................................................................................................................................................................................................................................................. | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| CACGGTTCTGCAGGCTGTACAGGAAGTGTAGTGGCTTCTCCTTCTGGGGAGAGTCAGGAAAGTTAGGATCATGGCAGAAGACAAAGGGGAGCAGGTGCGTCACATGGCCAGACCAGGAGCCACAGGAAGCAGGGAAGGTCTACACACTGTTAGGCAACTAGATCTTATGAGAACTCACACACTGTCATGAGAACAGCACCAGGAGTTTGTTCTAAACCATTCATGAAAGACCCACCCCATGTCCCAGTCATCTCCCACCAGGTCCCACCTTCACAATTGAGGATTATAATACAACATGAGATTTGGGGCAGGACACAGATCCAAACCACATCAGATACACATTGTGAAATGCTCATCATGGCCAAGGTAATTTGTATATCCATTTTCTCATGGAGCTACCATTTTATTT ..................................................................................................................................................................................................................................................(((((..(((((((....))......(((((....)))))...............))))))))))...................................................................................................... ............................................................................................................................................................................................................................................237...................................................................307.................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040024(GSM532909) G613N. (cervix) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR191459(GSM715569) 32genomic small RNA (size selected RNA from t. (breast) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189787 | SRR189786 | SRR191409(GSM715519) 19genomic small RNA (size selected RNA from t. (breast) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR040018(GSM532903) G701N. (cervix) | SRR029124(GSM416753) HeLa. (hela) | SRR037936(GSM510474) 293cand1. (cell line) | TAX577580(Rovira) total RNA. (breast) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191469(GSM715579) 117genomic small RNA (size selected RNA from . (breast) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR191421(GSM715531) 122genomic small RNA (size selected RNA from . (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040029(GSM532914) G026T. (cervix) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR191416(GSM715526) 34genomic small RNA (size selected RNA from t. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR040014(GSM532899) G623N. (cervix) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR191474(GSM715584) 16genomic small RNA (size selected RNA from t. (breast) | SRR191422(GSM715532) 129genomic small RNA (size selected RNA from . (breast) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM532879(GSM532879) G659N. (cervix) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | GSM532887(GSM532887) G761N. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | GSM532886(GSM532886) G850T. (cervix) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR553576(SRX182782) source: Testis. (testes) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................................................................................................................................................................................................................................................................................AGGACACAGATCCAAACCACTG.............................................................................. | 22 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................................................................................................AGGACACAGATCCAAACCTG................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................................................CACCTTCACAATTGATTAG............................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..CGGTTCTGCAGGCTGAAT..................................................................................................................................................................................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................................................................................................AGGACACAGATCCAACTG.................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................................................................................................AGGACACAGATCCAAACCCTG............................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..CGGTTCTGCAGGCTGCGT..................................................................................................................................................................................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................TCCCAGTCATCTCCCATCT..................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................................................TCATCTCCCACCAGGTCCCAAA............................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................................................................................................CAGGACACAGATCCAGGGC.................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................................GTCATCTCCCACCAGGTCGAA.............................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................TTAGGCAACTAGATCTGGA................................................................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |