| (3) AGO1.ip | (4) AGO2.ip | (2) AGO3.ip | (4) B-CELL | (3) BRAIN | (9) BREAST | (21) CELL-LINE | (7) CERVIX | (1) FIBROBLAST | (4) HEART | (5) HELA | (5) OTHER | (24) SKIN | (1) TESTES | (1) XRN.ip |
| GCTCTCCGGCCCCCAGCTCGGGATCACACGGCTGAGGGGAGGAATGGGGCGGGGCCTCTCATCTGGGGTGGGGCCCTGTGGGCCGCGCAGACGCCTCCAGCACACACAAGAGGCAGGAACCTCGGATCCTGGAGCTGGGGGTGCTGGAGGGGCACGGGGGTCCCAGCTCTGACCCAGGCTCTCGGCCCTGTCTCCTCCAGCCTCCGGTCACTGTGTCCAGCCCACCCTTCCCAGTTCCTGTCTACACCCG ...................................................................(((.(((((...))))).)))...((((((((((.((.....((((......))))......))..))))))))))(((((((((.((.((((((..(((.(((...))))))...))))))))))))))))).................................................. ..................................................................67...................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR040018(GSM532903) G701N. (cervix) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR189783 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189786 | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | SRR040030(GSM532915) G013N. (cervix) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR191485(GSM715595) 123genomic small RNA (size selected RNA from . (breast) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR040013(GSM532898) G648T. (cervix) | GSM532876(GSM532876) G547T. (cervix) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR189787 | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR040028(GSM532913) G026N. (cervix) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR040023(GSM532908) G575T. (cervix) | SRR037937(GSM510475) 293cand2. (cell line) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191551(GSM715661) 32genomic small RNA (size selected RNA from t. (breast) | SRR191617(GSM715727) 104genomic small RNA (size selected RNA from . (breast) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040006(GSM532891) G601N. (cervix) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR029130(GSM416759) DLD2. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGT................................................. | 22 | 1 | 48.00 | 11.00 | 12.00 | 3.00 | 2.00 | - | - | 3.00 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | 2.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 2.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - |
| .......................................................................GGCCCTGTGGGCCGCCGG................................................................................................................................................................. | 18 | 31.00 | 0.00 | - | - | - | - | 3.00 | - | - | - | - | 3.00 | 1.00 | 2.00 | - | - | - | 2.00 | - | 2.00 | - | 2.00 | 1.00 | 1.00 | 2.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGA................................................. | 22 | 1 | 13.00 | 11.00 | 4.00 | - | 2.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAG.................................................. | 21 | 1 | 11.00 | 11.00 | 4.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTA................................................ | 23 | 1 | 5.00 | 11.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGAT................................................ | 23 | 1 | 3.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAT.................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGC................................................. | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCATT................................................. | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTAA............................................... | 24 | 1 | 2.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................CTCTCGGCCCTGTCTCCTCCAGT................................................. | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTT................................................ | 23 | 1 | 2.00 | 11.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAATT................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................TCTCCTCCAGCCTCCGGCTT........................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTAT............................................... | 24 | 1 | 1.00 | 11.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................GGGCACGGGGGTCCCC..................................................................................... | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................TGGGGTGGGGCCCTGTGGCTG...................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTTAA.............................................. | 25 | 1 | 1.00 | 11.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................CTGGGGTGGGGCCCTGCTGT........................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAAT................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................GGGCACGGGGGTCCCCGTC.................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCAGTC................................................ | 23 | 1 | 1.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCC.................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................CTCGGCCCTGTCTCCTCCAGT................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ...................................................................................................................................................................................TCTCGGCCCTGTCTCCTCCATAA................................................ | 23 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................TGGGGTGGGGCCCTGTGGCTGT..................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................GGCACGGGGGTCCCAGT................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................GCACGGGGGTCCCAG.................................................................................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................CACGGGGGTCCCAGC................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |
| .....................................................................................................................................GCTGGGGGTGCTGGAGG.................................................................................................... | 17 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCTCTCCGGCCCCCAGCTCGGGATCACACGGCTGAGGGGAGGAATGGGGCGGGGCCTCTCATCTGGGGTGGGGCCCTGTGGGCCGCGCAGACGCCTCCAGCACACACAAGAGGCAGGAACCTCGGATCCTGGAGCTGGGGGTGCTGGAGGGGCACGGGGGTCCCAGCTCTGACCCAGGCTCTCGGCCCTGTCTCCTCCAGCCTCCGGTCACTGTGTCCAGCCCACCCTTCCCAGTTCCTGTCTACACCCG ...................................................................(((.(((((...))))).)))...((((((((((.((.....((((......))))......))..))))))))))(((((((((.((.((((((..(((.(((...))))))...))))))))))))))))).................................................. ..................................................................67...................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR040018(GSM532903) G701N. (cervix) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR189783 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189786 | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | SRR040030(GSM532915) G013N. (cervix) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR191485(GSM715595) 123genomic small RNA (size selected RNA from . (breast) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR040013(GSM532898) G648T. (cervix) | GSM532876(GSM532876) G547T. (cervix) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR189787 | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR040028(GSM532913) G026N. (cervix) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR040023(GSM532908) G575T. (cervix) | SRR037937(GSM510475) 293cand2. (cell line) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191551(GSM715661) 32genomic small RNA (size selected RNA from t. (breast) | SRR191617(GSM715727) 104genomic small RNA (size selected RNA from . (breast) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040006(GSM532891) G601N. (cervix) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR029130(GSM416759) DLD2. (cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444050(SRX128898) Sample 10cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................................................................................CTTCCCAGTTCCTGTACGA..... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................TCCTCCAGCCTCCGGTCG........................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................GTCCAGCCCACCCTTCAA.................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................CCAGTTCCTGTCTACAACA. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................GGGCCGCGCAGACGCCGT......................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................GGGGAGGAATGGGGCCCC..................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................CTGTCTCCTCCAGCCTTAAA........................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................CCCCATTCCTCCCCTCAG......................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................GTCTCCTCCAGCCTCCCC........................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................CTTCCCAGTTCCTGTACAA..... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................CCCCAGATGAGAGGC...................................................................................................................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................CCCCTCCAGCACCCCCA.................................................................................................. | 17 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................CCCCCGTGCCCCTCC.......................................................................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |