| (1) AGO2.ip | (7) BREAST | (5) CELL-LINE | (11) CERVIX | (1) OTHER | (52) SKIN |
| GCCCACCGGCCATGCCTGGGGGCGCTCCTGGGGTCTTTTAGGCACAGAACCCTCACTTGAGTCTTTGTCCCAGAGCTATCTGGTGAGTTCCCCAGGGGAGGGTCAAGCCCAGCAAGAGACAGAATCTGAGGGCCCAGGAGGCCTCTGGGAAGGAAACCTGCCCCCCGGCCCCTCATGCCTGCTGACCCTCCCTCCTGCAGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTG ..............................................................................................................................((((((.((.((.(((....((........)).))).)).)).))))))........................................................................... ......................................................................................................................119.........................................................179..................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040015(GSM532900) G623T. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040018(GSM532903) G701N. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR040032(GSM532917) G603N. (cervix) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | GSM532876(GSM532876) G547T. (cervix) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040007(GSM532892) G601T. (cervix) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040029(GSM532914) G026T. (cervix) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR040028(GSM532913) G026N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | SRR040022(GSM532907) G575N. (cervix) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577579(Rovira) total RNA. (breast) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................CTGCCCCCCGGCCCCGCG........................................................................... | 18 | 115.00 | 0.00 | 11.00 | 4.00 | 6.00 | 6.00 | 4.00 | 3.00 | 2.00 | 4.00 | 2.00 | 3.00 | 4.00 | 4.00 | 2.00 | 3.00 | 3.00 | 3.00 | 1.00 | 3.00 | 2.00 | 2.00 | - | - | - | 2.00 | 2.00 | 1.00 | 2.00 | 2.00 | 1.00 | 2.00 | 2.00 | - | 1.00 | 1.00 | 2.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | |
| .............................................................................................................................................................CTGCCCCCCGGCCCCGCGT.......................................................................... | 19 | 26.00 | 0.00 | 2.00 | 2.00 | - | - | 1.00 | 2.00 | 3.00 | - | 2.00 | 1.00 | - | - | 1.00 | - | - | - | 2.00 | - | 1.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | |
| ...............................................................................................................................................................GCCCCCCGGCCCCTCG........................................................................... | 16 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | |
| ...............................................................................................................................................................GCCCCCCGGCCCCTCGTC......................................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................GCCCCCCGGCCCCTCGTCC........................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................ATCTGAGGGCCCAGGGTT............................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................CCCCCCGGCCCCTCATCA........................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................AATCTGAGGGCCCAGGGTTC............................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................ATCTGAGGGCCCAGGGTTT............................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ........................................................................................................................................................................................................................................GAGCAGTATGAGGTCGTG | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................GCCCCCCGGCCCCTCTTC......................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CTGCCCCCCGGCCCCGTG........................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CTGCCCCCCGGCCCCGTC........................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| .............................................................................................................................................................CTGCCCCCCGGCCCCTCG........................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................CCTGCCCCCCGGCCCCGCGT.......................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CTGCCCCCCGGCCCCCGTC.......................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................AGAGCTATCTGGTGAG................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCCCACCGGCCATGCCTGGGGGCGCTCCTGGGGTCTTTTAGGCACAGAACCCTCACTTGAGTCTTTGTCCCAGAGCTATCTGGTGAGTTCCCCAGGGGAGGGTCAAGCCCAGCAAGAGACAGAATCTGAGGGCCCAGGAGGCCTCTGGGAAGGAAACCTGCCCCCCGGCCCCTCATGCCTGCTGACCCTCCCTCCTGCAGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTG ..............................................................................................................................((((((.((.((.(((....((........)).))).)).)).))))))........................................................................... ......................................................................................................................119.........................................................179..................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040015(GSM532900) G623T. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040018(GSM532903) G701N. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR040032(GSM532917) G603N. (cervix) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | GSM532876(GSM532876) G547T. (cervix) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040007(GSM532892) G601T. (cervix) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040029(GSM532914) G026T. (cervix) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR040028(GSM532913) G026N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | SRR040022(GSM532907) G575N. (cervix) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577579(Rovira) total RNA. (breast) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................................................................GCCCCCAGCCGGCCCCGGG.......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................GCCGGCTGGGGGCAATCGCTGC................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................GGCGCTCCTGGGGTCGTG.................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |