| (2) BREAST | (16) CELL-LINE | (2) CERVIX | (2) FIBROBLAST | (8) HEART | (1) HELA | (1) LIVER | (4) OTHER | (33) SKIN | (1) XRN.ip |
| ATTTTTGATTTTAAAAAATTTTTGTTATTTTTATATGTTTTATACTTATATGATTATTACTATAATAAAAATACTTAACTGTGGAAAGACTTAATCAGTGGATGGAATTTTTAGGGAAATTATTCTACCCCAGAAAACTCTTAGTATAAATGGATGTGTATGTTTCAGGATAAGCTTTTTTTTGTTTATTTTTCTTTCAGACATGATATATCAGATAAAAGTAGTTCTGACACTTCTATTCGGGTTCGTA .......................................................................................................................(((((((....((....(((((..........))).))...))....)))))))............................................................................. .....................................................................................................................118.................................................................186.............................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR029128(GSM416757) H520. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR189782 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189785 | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040025(GSM532910) G613T. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR189786 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................TTCTACCCCAGAAAAC................................................................................................................ | 16 | 5 | 30.80 | 30.80 | 3.80 | - | 4.40 | 2.60 | - | 3.00 | 4.00 | 1.60 | 2.00 | - | - | - | 2.40 | 0.80 | - | - | - | 0.60 | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.60 | 0.40 | 0.60 | 0.20 | 0.40 | 0.40 | 0.20 | - | - | - | - | - | 0.20 | - | - | 0.20 | 0.20 | - | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | - | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | - | - | - |
| ..........................................................................................................................TTCTACCCCAGAAAACA............................................................................................................... | 17 | 5 | 8.20 | 30.80 | 0.40 | - | 1.00 | 0.40 | - | 1.20 | 0.40 | 1.40 | 0.80 | - | - | 0.40 | - | 0.80 | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | 0.20 | - | - | - | - | - | 0.20 | - | 0.20 | - | 0.20 | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................ACTCTTAGTATAAATGGATGTGTATGTTTCAGGATAAGCTTTTTTTTGTTTATTTTTCTTTCAG.................................................. | 64 | 1 | 6.00 | 6.00 | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TCTACCCCAGAAAACT............................................................................................................... | 16 | 5 | 5.60 | 5.60 | 2.40 | - | - | 0.60 | - | 0.40 | - | 0.40 | 0.40 | - | - | - | - | - | - | - | - | 0.20 | - | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | 0.20 | - | - | - | 0.20 | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TCTACCCCAGAAAAC................................................................................................................ | 15 | 9 | 4.22 | 4.22 | 0.89 | - | 0.11 | 0.44 | - | 0.22 | 0.11 | 0.44 | - | - | - | - | - | - | - | - | - | 0.78 | - | 0.56 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.22 | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | 0.11 | 0.11 |
| ..........................................................................................................................TTCTACCCCAGAAAACT............................................................................................................... | 17 | 4 | 3.25 | 3.25 | 0.25 | 0.25 | - | 1.25 | - | - | - | 0.25 | - | - | - | - | - | 0.75 | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................ATTCTACCCCAGAAAACT............................................................................................................... | 18 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TCAGGATAAGCTTTTGCA.................................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................TATATCAGATAAAAGTAGTTCT...................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................TATTCTACCCCAGAAAA................................................................................................................. | 17 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTCTACCCCAGAAAACATC............................................................................................................. | 19 | 5 | 1.60 | 30.80 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.60 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................TATTCTACCCCAGAAAAC................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TCAGGATAAGCTTTTG...................................................................... | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................TGTATGTTTCAGGATATG............................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................CTTTTTTTTGTTTATATAG......................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................TTATATGTTTTATACTTTAG........................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................AAATACTTAACTGTGCAGG................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................ATTCTACCCCAGAAAACTAC............................................................................................................. | 20 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................ATTCTACCCCAGAAAACTACG............................................................................................................ | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................TTTTTTTTGTTTATTTTAATC...................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................TTCTACCCCAGAAAAAACA............................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CAGTGGATGGAATTTCATA........................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................ACTCTTAGTATAAATAGT................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................GGAATTTTTAGGGAAACAAA............................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................AGATAAAAGTAGTTCTGACA.................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................CTTTTTTTTGTTTATCTT.......................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TTTTGTTTATTTTTCTTTCAGTTGG.............................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................TCTACCCCAGAAAACTACAA........................................................................................................... | 20 | 5 | 0.20 | 5.60 | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTCTACCCCAGAAAACCACG............................................................................................................ | 20 | 5 | 0.20 | 30.80 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TCTACCCCAGAAAACTTGGC........................................................................................................... | 20 | 5 | 0.20 | 5.60 | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................TTTTTGTTATTTTTATAT...................................................................................................................................................................................................................... | 18 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ATTTTTGATTTTAAAAAATTTTTGTTATTTTTATATGTTTTATACTTATATGATTATTACTATAATAAAAATACTTAACTGTGGAAAGACTTAATCAGTGGATGGAATTTTTAGGGAAATTATTCTACCCCAGAAAACTCTTAGTATAAATGGATGTGTATGTTTCAGGATAAGCTTTTTTTTGTTTATTTTTCTTTCAGACATGATATATCAGATAAAAGTAGTTCTGACACTTCTATTCGGGTTCGTA .......................................................................................................................(((((((....((....(((((..........))).))...))....)))))))............................................................................. .....................................................................................................................118.................................................................186.............................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR029128(GSM416757) H520. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR189782 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189785 | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040025(GSM532910) G613T. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR189786 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................AGTTTTCTGGGGTAGAA............................................................................................................... | 17 | 4 | 2.00 | 2.00 | - | - | - | - | 1.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTCTACCCCAGAAAACTC.............................................................................................................. | 18 | 4 | 1.50 | 0.00 | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTTTCTGGGGTAGAA................................................................................................................. | 15 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................GTATAAATGGATGTGTATGTGT..................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................GAATTTTTAGGGAAATTATTA............................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................AAATTATTCTACCCCAGTA................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................TTTTTTTTGTTTATTTTTCTTTAAA.................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................TCTACCCCAGAAAACTCC............................................................................................................. | 18 | 5 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TCTACCCCAGAAAACTC.............................................................................................................. | 17 | 5 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |