| (1) AGO2.ip | (2) BRAIN | (5) BREAST | (10) CELL-LINE | (3) CERVIX | (1) FIBROBLAST | (1) HEART | (3) LIVER | (2) OTHER | (46) SKIN |
| ACATCCCGGGGCTGCGGGGGTAGGCGGTGTGAAGCGAATTATGTAAAGAGGTAATGAAGCGCACCGTTGTCAAACCCCAAGGGAGAGTTGTGGCTCTTGTCTCCCGCTGTTAGTCTGCACATCATACTGTCTTTGAAGCAAGGAGTTGATTTTAGTCTATGTATCTAAAGTTGAAATGTTTAGGTCCTTTACCTTTTCAAACGTGTTGCCCGTATTAGACAACAGTTTGCTAACAATTTTTTTAGAGAGC .................................................................................................................((((.((((.......((((((...)))))).((((((((((.........)))))))))).)))).)))).................................................................. .................................................................................................................114..............................................................................195..................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR040028(GSM532913) G026N. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR040019(GSM532904) G701T. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR040027(GSM532912) G220T. (cervix) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189782 | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCACTA........................................................... | 20 | 2 | 22.50 | 0.50 | - | 3.50 | 4.00 | 0.50 | 1.00 | 0.50 | - | - | 1.00 | - | 1.00 | 1.50 | 1.00 | - | - | 0.50 | - | - | 0.50 | 0.50 | 0.50 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | 0.50 | - | 0.50 | - | - | - | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCACT............................................................ | 19 | 2 | 13.50 | 0.50 | - | 1.50 | 0.50 | 0.50 | 0.50 | 1.00 | - | - | 0.50 | 0.50 | 0.50 | - | 0.50 | 1.50 | 0.50 | - | - | - | 0.50 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | 0.50 | 0.50 | - | 0.50 | - | - | 0.50 | 0.50 | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCTCTAG.......................................................... | 21 | 7.00 | 0.00 | 6.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................GTTGAAATGTTTAGGAC................................................................ | 17 | 6.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGAAATGTTTAGGTC................................................................ | 15 | 7 | 5.57 | 5.57 | - | 0.71 | - | - | 0.29 | 0.14 | - | - | - | - | - | - | - | - | 0.86 | 0.43 | - | 0.14 | 0.14 | 0.57 | 0.57 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | 0.14 | 0.14 | 0.14 | 0.14 | 0.14 | 0.14 |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCTCTTG.......................................................... | 21 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................CACATCATACTGTCTTTGAAGCAAGGAG......................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TTGAAATGTTTAGGTCCTCT............................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCAC............................................................. | 18 | 2 | 1.00 | 0.50 | - | - | - | 0.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................ACATCATACTGTCTTGTT.................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCTAT............................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................AAGCGCACCGTTGTCAAACCC............................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................CGTTGTCAAACCCCAAGGGAGAGTTGTGGCT........................................................................................................................................................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TGGCTCTTGTCTCCCGCTGTTAGT........................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCAA............................................................. | 18 | 2 | 1.00 | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TTTGAAGCAAGGAGTTGA..................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................GGCGGTGTGAAGCGAATTATGTAAAGAG........................................................................................................................................................................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCTCTCG.......................................................... | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................TGGCTCTTGTCTCCCGCTGTTAGTCCGCA................................................................................................................................... | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............TGCGGGGGTAGGCGGTGT............................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCTTTTGT......................................................... | 22 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCAATA........................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCC............................................................... | 16 | 2 | 0.50 | 0.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCATTT........................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCATTA........................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCCCT............................................................ | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCCAAA............................................................ | 19 | 2 | 0.50 | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............TGCGGGGGTAGGCGG............................................................................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| ............TGCGGGGGTAGGCGGGCGG........................................................................................................................................................................................................................... | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................TTGAAATGTTTAGGTC................................................................ | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCAAGT............................................................ | 19 | 7 | 0.14 | 5.57 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGAAATGTTTAGGTCAACT............................................................ | 19 | 7 | 0.14 | 5.57 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ACATCCCGGGGCTGCGGGGGTAGGCGGTGTGAAGCGAATTATGTAAAGAGGTAATGAAGCGCACCGTTGTCAAACCCCAAGGGAGAGTTGTGGCTCTTGTCTCCCGCTGTTAGTCTGCACATCATACTGTCTTTGAAGCAAGGAGTTGATTTTAGTCTATGTATCTAAAGTTGAAATGTTTAGGTCCTTTACCTTTTCAAACGTGTTGCCCGTATTAGACAACAGTTTGCTAACAATTTTTTTAGAGAGC .................................................................................................................((((.((((.......((((((...)))))).((((((((((.........)))))))))).)))).)))).................................................................. .................................................................................................................114..............................................................................195..................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR040028(GSM532913) G026N. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR040019(GSM532904) G701T. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR040027(GSM532912) G220T. (cervix) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189782 | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................TGTAAAGAGGTAATGGTGA.............................................................................................................................................................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................GTCCTTTACCTTTTCGTTC................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............GCGGGGGTAGGCGGTGGTGG......................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................GGTCCTTTACCTTTTCAAAGAG.............................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............GCGGGGGTAGGCGGTGGG........................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................TGTTGCCCGTATTAGAA.............................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................CATCATACTGTCTTTATTA................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................TGTAAAGAGGTAATGGT................................................................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................CTAAAATCAACTCCTT............................................................................................... | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |