| (2) AGO2.ip | (28) B-CELL | (12) BRAIN | (5) BREAST | (21) CELL-LINE | (1) HEART | (6) LIVER | (2) OTHER | (5) SKIN | (1) TESTES | (1) XRN.ip |
| GGGTGGGTGTAGAGAAGGCTTCCTCTACCACCTTCACCCTTGACCTTGTCTCTTTCTGCCTGCCTGTGGCTATAGAAGTGGCCTACACTGCAGGACCTGGCCAGTGCTTCCCTGGAGGTGAGAGCCACCCTAGGGTAGGGGAAATAGGAACAATAGAGGGACTGACGGGTGATCTCTTTGACCTCTGATCCTACCCACAGGAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTATTCTCGTGGCCGGCG .................................................................................................................................................................(((..((((((((............))))..)))).))).................................................. .....................................................................................................................................................150...............................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | TAX577580(Rovira) total RNA. (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038861(GSM458544) MM466. (cell line) | TAX577590(Rovira) total RNA. (breast) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................................................AGAGGGACTGACGGGGGCA............................................................................. | 19 | 3 | 98.00 | 0.67 | 14.00 | 14.00 | 6.00 | 1.00 | 2.00 | 3.00 | 5.00 | - | - | 5.00 | 2.00 | 2.00 | 3.00 | - | 2.00 | 2.00 | - | 1.00 | 2.00 | 2.00 | - | - | 3.00 | - | 3.00 | - | 2.00 | 2.00 | 1.00 | 2.00 | - | 2.00 | - | - | 1.00 | 2.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGC.............................................................................. | 18 | 3 | 38.00 | 0.67 | - | - | 1.00 | 2.00 | 5.00 | 2.00 | 3.00 | - | - | - | 2.00 | 2.00 | - | 3.00 | 1.00 | - | - | - | 1.00 | - | 2.00 | 1.00 | - | - | - | 3.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGG............................................................................... | 17 | 3 | 19.00 | 0.67 | - | - | 2.00 | 2.00 | 1.00 | 1.00 | - | 7.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................TTGACCTCTGATCCTACCCACT................................................... | 22 | 7.00 | 0.00 | - | - | - | - | - | - | - | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................AGAGGGACTGACGGGGAA.............................................................................. | 18 | 3 | 6.00 | 0.67 | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................TTGACCTCTGATCCTACCCACA................................................... | 22 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................AGGGACTGACGGGTGCAT............................................................................ | 18 | 5.00 | 0.00 | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................CCTACACTGCAGGACCTGGCCAGTATC.............................................................................................................................................. | 27 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................AGAGGGACTGACGGGCATT............................................................................. | 19 | 3 | 2.00 | 0.67 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................GGGACTGACGGGTGATCTCTTTGA..................................................................... | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................GGGACTGACGGGTGATCTCTTTGACCTCTG............................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGTA............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................................ATTCTCGTGGCCGGCTCCA | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................GGGACTGACGGGTGATC............................................................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................TGAGAGCCACCCTAGGGTAGGGGAAATAGGAAC................................................................................................... | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGCCG............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGCAT............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGT.............................................................................. | 18 | 3 | 1.00 | 0.67 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGAC.............................................................................. | 18 | 3 | 1.00 | 0.67 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGTGC.............................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................AACTCTGGGCTGGCCTGGGCTACTAT.............. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGCG............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................TCTGATCCTACCCACAG.................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................TTGACCTCTGATCCTACCCACAG.................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .GGTGGGTGTAGAGAAGTGCA..................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................AGGAACAATAGAGGGACTGACGGG................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGG.............................................................................. | 18 | 3 | 1.00 | 0.67 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TTTGACCTCTGATCCTACCCACA................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .....................................CCTTGACCTTGTCTCGGTC.................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................TAGAGGGACTGACGGGTGA.............................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................AACTCTGGGCTGGCCTGGGCTACT................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................GGGTAGGGGAAATAGGAAC................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGCA.............................................................................. | 18 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGGGA............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................GAAGTGGCCTACACTGCAGGACCTGGCCAGTG................................................................................................................................................ | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGAGGGACTGACGGGGCCA............................................................................. | 19 | 3 | 1.00 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................CCTTGACCTTGTCTCTTTATG................................................................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................TCTTTGACCTCTGATCCTACCCACAG.................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................AGGGACTGACGGGTGCATT........................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................AGAGGGACTGACGGG................................................................................. | 15 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - |
| ....GGGTGTAGAGAAGGC....................................................................................................................................................................................................................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| GGGTGGGTGTAGAGAAGGCTTCCTCTACCACCTTCACCCTTGACCTTGTCTCTTTCTGCCTGCCTGTGGCTATAGAAGTGGCCTACACTGCAGGACCTGGCCAGTGCTTCCCTGGAGGTGAGAGCCACCCTAGGGTAGGGGAAATAGGAACAATAGAGGGACTGACGGGTGATCTCTTTGACCTCTGATCCTACCCACAGGAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTATTCTCGTGGCCGGCG .................................................................................................................................................................(((..((((((((............))))..)))).))).................................................. .....................................................................................................................................................150...............................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015362(GSM380327) NaÌøve B Cell (Naive138). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | TAX577580(Rovira) total RNA. (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR038861(GSM458544) MM466. (cell line) | TAX577590(Rovira) total RNA. (breast) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................................TCTGATCCTACCCACAAGT................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................GTGCTTCCCTGGAGGGGC................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................CTTTCTGCCTGCCTGTT...................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................TGGCCTACACTGCAGTTAT......................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................ACCACCTTCACCCTTGTG.............................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| .....................................................................................................................................TTCCTATTTCCCCTACC.................................................................................................... | 17 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 | - |