| (2) AGO2.ip | (4) B-CELL | (1) BRAIN | (6) BREAST | (16) CELL-LINE | (11) CERVIX | (1) HEART | (3) LIVER | (3) OTHER | (1) RRP40.ip | (27) SKIN | (1) TESTES | (1) UTERUS | (1) XRN.ip |
| CAGTGCTGGAGTTCCTATATACCAACAGTGTCAAGCTGTACCGCCACTCTGTGAGCCTGCTGACCAGGGGCCTGGGTGGGAGAGGTGGGGGGTGCCAGAGGCAGGAGTTTGCCCATTACACTGTGGGCACAGGGCAGGGGAAACTCCCTTCCACTCCCCCAACCACCCACTCTACAGGTGCTGGAAGTGCTGACAGCGGCTGTGGAGTATGGGCTGGAGGAACTGAG ..........................................................................((((.....((((((.((((((...)))).....)).)))))).))))......................................................................................................... .......................................................................72...................................................125.................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR189782 | SRR189784 | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040036(GSM532921) G243N. (cervix) | TAX577739(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR040037(GSM532922) G243T. (cervix) | SRR189786 | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040013(GSM532898) G648T. (cervix) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR040025(GSM532910) G613T. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577453(Rovira) total RNA. (breast) | SRR040035(GSM532920) G001T. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR040041(GSM532926) G612T. (cervix) | SRR037936(GSM510474) 293cand1. (cell line) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR191576(GSM715686) 86genomic small RNA (size selected RNA from t. (breast) | SRR040011(GSM532896) G529T. (cervix) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR040008(GSM532893) G727N. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR040033(GSM532918) G603T. (cervix) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR040012(GSM532897) G648N. (cervix) | SRR038863(GSM458546) MM603. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR444051(SRX128899) Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................TGGGAGAGGTGGGGGGTG..................................................................................................................................... | 18 | 2 | 12.00 | 12.00 | - | - | - | - | 1.50 | - | - | - | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | 0.50 | - | 0.50 | 0.50 | 0.50 | - | - | 0.50 | 0.50 | 0.50 | - | 0.50 | - | 0.50 | 0.50 | - | - | - | 0.50 | - | 0.50 | 0.50 | 0.50 | - | 0.50 | - | - | - | - | - | - |
| ...........................................................................GTGGGAGAGGTGGGGGGTG..................................................................................................................................... | 19 | 2 | 9.50 | 9.50 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 0.50 | - | 0.50 | 1.00 | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - | 0.50 | - | - | - | - | 0.50 | - | - | - | 0.50 | - | 0.50 | - | - | 0.50 | 0.50 | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - |
| ................................................................................................AGAGGCAGGAGTTTGCACAG............................................................................................................... | 20 | 6.00 | 0.00 | - | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGTGCT................................................................................................................ | 19 | 5.00 | 0.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................GCTGACAGCGGCTGTGGAG.................... | 19 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................TGACAGCGGCTGTGGAGTATGGGCTGGAG........ | 29 | 1 | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................TGGGAGAGGTGGGGGGGGG.................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GTGGGAGAGGTGGGGGG....................................................................................................................................... | 17 | 3 | 1.67 | 1.67 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | 0.33 | - | - |
| ..........................................................................GGTGGGAGAGGTGGGGAAAG..................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................TGGGAGAGGTGGGGGGTGGTA.................................................................................................................................. | 21 | 2 | 1.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................AGAGGCAGGAGTTTGTA.................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................TGGAAGTGCTGACAGCGGCTGTGGAGT................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................AGAGGCAGGAGTTTGCCCAGTGA............................................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CAGAGGCAGGAGTTTGCCCATTACA........................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................AGAGGCAGGAGTTTGCGCAG............................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................GTATGGGCTGGAGGAACT... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................CAGGAGTTTGCCCATTGGTT.......................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................GGCTGTGGAGTATGGGCTGGAGGAACTGAG | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................ACTCTGTGAGCCTGCTGACC.................................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................CCCATTACACTGTGGGCACAGGGCAG.......................................................................................... | 26 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................AGAGGCAGGAGTTTGTACG................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGTGGA................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGGAA................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................ACAGCGGCTGTGGAGAAA................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGCACAC............................................................................................................... | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGTACA................................................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................GAGTATGGGCTGGAGGAACTGAGCGAG | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................AGCGGCTGTGGAGTAAAA............... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................GGTGCTGGAAGTGCTGACAGCGGCTGC........................ | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................CTGGGTGGGAGAGGTCA........................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGGGCT................................................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................GCGGCTGTGGAGTATGGGGCC........... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................GGAAGTGCTGACAGCGGATAT........................ | 21 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................AGAGGCAGGAGTTTGGGAT................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................GTGGGCACAGGGCAGGGGAAAC................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................GTGGGAGAGGTGGGGGGGG..................................................................................................................................... | 19 | 3 | 0.67 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | 0.33 | - |
| ...........................................................................GTGGGAGAGGTGGGGGGT...................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................ACACTGTGGGCACAGGGCA........................................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................GTGGGAGAGGTGGGGGGTA..................................................................................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CAGTGCTGGAGTTCCTATATACCAACAGTGTCAAGCTGTACCGCCACTCTGTGAGCCTGCTGACCAGGGGCCTGGGTGGGAGAGGTGGGGGGTGCCAGAGGCAGGAGTTTGCCCATTACACTGTGGGCACAGGGCAGGGGAAACTCCCTTCCACTCCCCCAACCACCCACTCTACAGGTGCTGGAAGTGCTGACAGCGGCTGTGGAGTATGGGCTGGAGGAACTGAG ..........................................................................((((.....((((((.((((((...)))).....)).)))))).))))......................................................................................................... .......................................................................72...................................................125.................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR189782 | SRR189784 | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040036(GSM532921) G243N. (cervix) | TAX577739(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR040037(GSM532922) G243T. (cervix) | SRR189786 | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040013(GSM532898) G648T. (cervix) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR040025(GSM532910) G613T. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR033728(GSM497073) MALT (MALT413). (B cell) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | TAX577453(Rovira) total RNA. (breast) | SRR040035(GSM532920) G001T. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR040041(GSM532926) G612T. (cervix) | SRR037936(GSM510474) 293cand1. (cell line) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR191576(GSM715686) 86genomic small RNA (size selected RNA from t. (breast) | SRR040011(GSM532896) G529T. (cervix) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR040008(GSM532893) G727N. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR040033(GSM532918) G603T. (cervix) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR040012(GSM532897) G648N. (cervix) | SRR038863(GSM458546) MM603. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR444051(SRX128899) Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................GGTGGGAGAGGTGGGGGA....................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................CAGTGTCAAGCTGTAAA......................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................GCAGGAGTTTGCCCAAGT............................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................GGGGGGTGCCAGAGGCAGGAG........................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................GCCCATACTCCACAGCCGC............. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................TGGGCTGGAGGAACTAGG | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................CAGTGTCAAGCTGTAAAC........................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................CTTCCACTCCCCCAACAA.............................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................ACCTGTAGAGTGGGTGGTTGG................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........GAGTTCCTATATACCAACATG...................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................TGGCGGTACAGCTTGACACTGTTGG..................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................TGGAAGGGAGTTTCCCCTG.......................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TTCCAGCACCTGTAG......................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |