| (4) AGO2.ip | (1) BRAIN | (1) BREAST | (13) CELL-LINE | (8) CERVIX | (1) FIBROBLAST | (2) HEART | (1) KIDNEY | (4) LIVER | (4) OTHER | (28) SKIN | (1) UTERUS | (1) XRN.ip |
| AGGGCATAGGCAGAGCCTTTGCAGAGGCGCTGCTGCTTAAGGGCGCCAAGGTAAGCCCGGCGCCCAGCCGCGGAAATTTCTCTGCCCACACACTCCGAGACTCGCCCCGCCGCCCGAGGTGCACTGGCGGAGACAGGGAGGCCGCGCCCGGCGTGCCCACTTTGCCACTTCCAAAATTTGCTGAAGCTGAGGCTGTGAGCACACCTCAGAAGTGGCTGGGAGGGAACCCAAACCTAATTGCCAAATTTCA ......................................................(((.(((((......(((((......))))).......((((....((((((.((((......))))....)))).))....))))...))))).)))..((.(((...(((.((((...........))))....))).))).)).................................................. ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | GSM956925PAZD5 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189783 | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR189782 | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR040033(GSM532918) G603T. (cervix) | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR040027(GSM532912) G220T. (cervix) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR040007(GSM532892) G601T. (cervix) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR040041(GSM532926) G612T. (cervix) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532874(GSM532874) G699T. (cervix) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR040015(GSM532900) G623T. (cervix) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR040036(GSM532921) G243N. (cervix) | SRR189785 | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR040035(GSM532920) G001T. (cervix) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................CCCGGCGCCCAGCCGGGGA................................................................................................................................................................................ | 19 | 26.00 | 0.00 | 17.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................CCGGCGCCCAGCCGCCGGG............................................................................................................................................................................... | 19 | 12.00 | 0.00 | 7.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................CCCGGCGCCCAGCCGGGG................................................................................................................................................................................. | 18 | 4.00 | 0.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................CCCGGCGCCCAGCCGGGCG................................................................................................................................................................................ | 19 | 3.00 | 0.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGTAAGCCCGGCGCCCAGC...................................................................................................................................................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................GTGGCTGGGAGGGAACTG..................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................AGCCCGGCGCCCAGCGAC................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................GCTGAAGCTGAGGCTGTGAGC.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................CCCGGCGCCCAGCCGGGGG................................................................................................................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGTAAGCCCGGCGCCCCGC...................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................GAAGTGGCTGGGAGGCCG........................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................AAGTGGCTGGGAGGGAAGGGG.................... | 21 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................GGAAATTTCTCTGCCCACACACTCCGAG....................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................CCCCGCCGCCCGAGGCGGG............................................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................CCGGCGCCCAGCCGCGGG................................................................................................................................................................................ | 18 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................CAGAAGTGGCTGGGAAAAA......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................ACTCCGAGACTCGCCCCGCCGCCC....................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................CGCCAAGGTAAGCCCGG.............................................................................................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................CTGAAGCTGAGGCTGTGAGCA................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................GCCCCGCCGCCCGAGGACAA............................................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................GAAGTGGCTGGGAGGACG........................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................AGTGGCTGGGAGGGAACCCAAA.................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................CCCGGCGCCCAGCCGCGGGA............................................................................................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................TGAAGCTGAGGCTGTGAGCACACC............................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................CCCGGCGCCCAGCCGCGGGC............................................................................................................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................CGCCCCGCCGCCCGA..................................................................................................................................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - |
| .............................................................................................................................................................................................AGGCTGTGAGCACACC............................................. | 16 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AGGGCATAGGCAGAGCCTTTGCAGAGGCGCTGCTGCTTAAGGGCGCCAAGGTAAGCCCGGCGCCCAGCCGCGGAAATTTCTCTGCCCACACACTCCGAGACTCGCCCCGCCGCCCGAGGTGCACTGGCGGAGACAGGGAGGCCGCGCCCGGCGTGCCCACTTTGCCACTTCCAAAATTTGCTGAAGCTGAGGCTGTGAGCACACCTCAGAAGTGGCTGGGAGGGAACCCAAACCTAATTGCCAAATTTCA ......................................................(((.(((((......(((((......))))).......((((....((((((.((((......))))....)))).))....))))...))))).)))..((.(((...(((.((((...........))))....))).))).)).................................................. ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR444043(SRX128891) Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | GSM956925PazD5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | GSM956925PAZD5 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR189783 | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR189782 | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR040033(GSM532918) G603T. (cervix) | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR040027(GSM532912) G220T. (cervix) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR040007(GSM532892) G601T. (cervix) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR040041(GSM532926) G612T. (cervix) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532874(GSM532874) G699T. (cervix) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925AGO2Paz8(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR040015(GSM532900) G623T. (cervix) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR040036(GSM532921) G243N. (cervix) | SRR189785 | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR040035(GSM532920) G001T. (cervix) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................CTCGCCCCGCCGCCCGG..................................................................................................................................... | 17 | 10.33 | 0.00 | - | - | 4.67 | - | - | 1.33 | - | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | 0.33 | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................CGGGCGGCGGGGCGA...................................................................................................................................... | 15 | 3 | 7.33 | 7.33 | - | - | 1.33 | - | - | 0.33 | - | - | 0.33 | - | 1.33 | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | 0.33 | - | 0.67 | - | 0.33 | - | - | - | 0.33 | - | - | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | 0.33 | - | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................CTCGCCCCGCCGCCCGGC.................................................................................................................................... | 18 | 3.67 | 0.00 | 0.33 | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................CTCGCCCCGCCGCCCGGCGG.................................................................................................................................. | 20 | 3.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................AAGTGGCTGGGAGGGAATCT..................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................AGTGGCTGGGAGGGAGTAT..................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................CGCCCCGCCGCCCGAGG................................................................................................................................... | 17 | 5 | 1.00 | 0.00 | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 | - | - | - | 0.20 | - | - |
| .............................................................GCCCAGCCGCGGAAATTTTACT....................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................CCGCGGCTGGGCGCCGGG................................................................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................CCCACTTTGCCACTTCCAAAAAATA...................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................CGGGCGGCGGGGCGAG...................................................................................................................................... | 16 | 3 | 1.00 | 1.00 | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................TTTGGAAGTGGCAAAGTGG........................................................................... | 19 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................CGCCCCGCCGCCCGAGGG.................................................................................................................................. | 18 | 5 | 0.80 | 0.00 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | 0.20 | - | - | - |
| ....................................................................................................CTCGCCCCGCCGCCCGA..................................................................................................................................... | 17 | 0.67 | 0.00 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................GCCGGGCGCGGCCTCCC.................................................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................CGCCCCGCCGCCCGAGGAC................................................................................................................................. | 19 | 5 | 0.40 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................CTCGCCCCGCCGCCCGGCG................................................................................................................................... | 19 | 0.33 | 0.00 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................CGCCCCGCCGCCCGAGA................................................................................................................................... | 17 | 5 | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - |
| ......................................................................................................CGCCCCGCCGCCCGAGGGG................................................................................................................................. | 19 | 5 | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - |
| ......................................................................................................TCGGGCGGCGGGGCG..................................................................................................................................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - |
| ......................................................................................................CGCCCCGCCGCCCGAGGGC................................................................................................................................. | 19 | 5 | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................CGCCCCGCCGCCCGAG.................................................................................................................................... | 16 | 5 | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GGCTGGGCGCCGGGC..................................................................................................................................................................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |