| (1) AGO1.ip OTHER.mut | (1) B-CELL | (15) CELL-LINE | (6) CERVIX | (6) HEART | (4) HELA | (3) LIVER | (1) OTHER | (39) SKIN | (1) XRN.ip |
| TTAACCATTTGGTAGAACTCATATTTCCCCAACCAGTATGAAAGAGTGGAGTAGAGACTTCCCAGATGAGTTACAGTTCTATAAATTCCAAAGTTAAATAAATTCTACTATTGTCTCGTTTATTTGATCATGATGTATGTAAAACAGTGTCTTTTGTGGTATATTTTCCTCATGTAGTATTTTCTGTCAACCCAACACAGGTGCAAAAATACTTCTTGGAAATGAAAAATAAGATGCCTTCCTTATCTCC ..................................................................((.(((((((....(((.........(((((((((((...((....))...)))))))))))(((((...(((((..((((......))))..))))).....)))))...)))...)))).))).))........................................................ ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM532874(GSM532874) G699T. (cervix) | GSM359207(GSM359207) HepG2_tot_up. (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR040039(GSM532924) G531T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR040029(GSM532914) G026T. (cervix) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR040043(GSM532928) G428T. (cervix) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................................CTGTCAACCCAACACAGG................................................. | 18 | 2 | 29.50 | 29.50 | 10.00 | - | - | 1.00 | 3.00 | - | - | - | 1.00 | 2.00 | - | 0.50 | - | 1.00 | 0.50 | - | 1.00 | - | 1.50 | - | - | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | 0.50 | - | - | - | 0.50 | 0.50 | - | - | 0.50 | - | - | 0.50 | 0.50 | 0.50 | - | - | - | - | 0.50 | 0.50 | 0.50 | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAG.................................................. | 17 | 2 | 7.00 | 7.00 | 1.00 | - | 1.50 | 0.50 | - | - | - | - | - | - | - | 0.50 | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................ATGTAGTATTTTCTGTCAACCCAATC..................................................... | 26 | 6.00 | 0.00 | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................GTCAACCCAACACAGG................................................. | 16 | 2 | 6.00 | 6.00 | 1.50 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | - | - | - | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACA................................................... | 16 | 3 | 5.33 | 5.33 | - | - | - | 0.67 | - | - | - | - | - | - | 1.00 | 0.33 | - | 0.33 | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | 0.33 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGG................................................. | 17 | 2 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | 0.50 | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTTGATCATGATGTATGTAAAACAGTGTCTTTTGTGGTATATTTTCCTCATGTAGTATTTTCTGTCAACCCAACAC.................................................... | 76 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAG.................................................. | 16 | 3 | 2.67 | 2.67 | - | - | - | 0.33 | - | - | - | - | - | - | - | 0.33 | - | - | 0.33 | - | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGGAA............................................... | 18 | 2 | 2.50 | 6.00 | - | - | 2.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................TCAACCCAACACAGG................................................. | 15 | 9 | 2.33 | 2.33 | 1.44 | - | - | 0.11 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.22 | - | 0.11 | - | 0.11 |
| ........................................................................................................................................................................................TGTCAACCCAACACAGGCACA............................................. | 21 | 2 | 1.50 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAG.................................................. | 15 | 5 | 1.40 | 1.40 | 0.60 | - | - | 0.40 | - | - | - | - | 0.20 | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................TTGGAAATGAAAAATAAGATGCC............ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGGCATT............................................. | 20 | 2 | 1.00 | 6.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................TACTTCTTGGAAATGAAAAATA................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................TAAGATGCCTTCCTTATCT.. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................TGATCATGATGTATGTAAAACAGTGTCTTTTGTGGTATATTTTCCTCATGTAGTATTTTCTGTCAACC.......................................................... | 68 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................................ATGCCTTCCTTATCTCACTG | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................GTCAACCCAACACAGGCCTG............................................. | 20 | 2 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................GACTTCCCAGATGAGTCAG................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................GTGTCTTTTGTGGTAATT...................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................TTGATCATGATGTATGTAAAACAGTGTCTTTTGTGG........................................................................................... | 36 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................GGAAATGAAAAATAAGATGCC............ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................TTGGAAATGAAAAATAAGATGCCT........... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGGCAC.............................................. | 20 | 2 | 0.50 | 5.00 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGGCATA............................................. | 20 | 2 | 0.50 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGGCATT............................................. | 21 | 2 | 0.50 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGGCATA............................................. | 21 | 2 | 0.50 | 5.00 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAGGCATA............................................. | 22 | 2 | 0.50 | 29.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGGCC............................................... | 19 | 2 | 0.50 | 5.00 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAGGCAA.............................................. | 21 | 2 | 0.50 | 29.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGGCGA.............................................. | 19 | 2 | 0.50 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGGCATC............................................. | 20 | 2 | 0.50 | 6.00 | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAGGCC............................................... | 20 | 2 | 0.50 | 29.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................AAATAAGATGCCTTCCT....... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAGGCACC............................................. | 22 | 2 | 0.50 | 29.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CTGTCAACCCAACACAAAC................................................ | 19 | 3 | 0.33 | 5.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGTCGT.............................................. | 20 | 3 | 0.33 | 2.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACAGACA............................................... | 19 | 3 | 0.33 | 2.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGTCAACCCAACACA................................................... | 15 | 8 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - |
| .........................................................................................................................................................................................GTCAACCCAACACAGCTA............................................... | 18 | 5 | 0.20 | 1.40 | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................TCAACCCAACACAGGCATA............................................. | 19 | 9 | 0.11 | 2.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - |
| ........................................................................................................................TATTTGATCATGATGTA................................................................................................................. | 17 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TTAACCATTTGGTAGAACTCATATTTCCCCAACCAGTATGAAAGAGTGGAGTAGAGACTTCCCAGATGAGTTACAGTTCTATAAATTCCAAAGTTAAATAAATTCTACTATTGTCTCGTTTATTTGATCATGATGTATGTAAAACAGTGTCTTTTGTGGTATATTTTCCTCATGTAGTATTTTCTGTCAACCCAACACAGGTGCAAAAATACTTCTTGGAAATGAAAAATAAGATGCCTTCCTTATCTCC ..................................................................((.(((((((....(((.........(((((((((((...((....))...)))))))))))(((((...(((((..((((......))))..))))).....)))))...)))...)))).))).))........................................................ ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM532874(GSM532874) G699T. (cervix) | GSM359207(GSM359207) HepG2_tot_up. (cell line) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR040039(GSM532924) G531T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR040029(GSM532914) G026T. (cervix) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR040043(GSM532928) G428T. (cervix) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................CTTTGGAATTTATAGAA............................................................................................................................................................. | 17 | 2 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTTCTGTCAACCCAACAAAA.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TTTTCTGTCAACCCAACAC.................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................GGAAATGAAAAATAAGGG............... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....CATTTGGTAGAACTCTTG................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................CCTGTGTTGGGTTGA................................................. | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |