| (2) AGO2.ip | (5) B-CELL | (6) BRAIN | (4) BREAST | (11) CELL-LINE | (4) HEART | (2) HELA | (2) LIVER | (2) OTHER | (10) SKIN | (1) TESTES | (1) XRN.ip |
| AAGGTCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGTGAGTGCCAGGACAGGTGGAAGAATGGGGCAGGGCCAGAACAAGGCCCCACTGAGCTGCCTGCCCTCCTGCACCCCCAGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTAGGGTA ......................................................((.(((...............))).)).(((((.......)))))................................................................................. ..................................................51..............................................99................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038854(GSM458537) MM653. (cell line) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR191525(GSM715635) 121genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577738(Rovira) total RNA. (breast) | SRR029131(GSM416760) MCF7. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAATGGGGCAGGGCCAGAACAAGGCCCCACTGAGCTGCCTGCCCTCCTGCACCCCCAG.................................................. | 80 | 1 | 11.00 | 11.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................CGAGGCCTGGAAGTTCCTC........ | 19 | 1 | 9.00 | 9.00 | - | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGCCAGGACAGGTGG.............................................................................................................. | 19 | 1 | 6.00 | 6.00 | 1.00 | - | - | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................TGCCAGGACAGGTGGAAGAATGG...................................................................................................... | 23 | 1 | 5.00 | 5.00 | - | - | - | - | 3.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGG.............................................................................................................. | 20 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAAT........................................................................................................ | 26 | 1 | 3.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAT........................................................................................................... | 23 | 3.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | |
| ..................................................GTGAGTGCCAGGACAGGTGGAAG........................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................CCAGGACAGGTGGAAGAATGGGGC................................................................................................... | 24 | 1 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAATGG...................................................................................................... | 28 | 1 | 2.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGCCAGGACAGGTGGAAGA.......................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................CTGAGCTGAAGAACCGGA............................................................................................................................................. | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAA......................................................................................................... | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGA............................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGCCAGGACAGGTGGAAG........................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................ATGGGGCAGGGCCAGAACAAGGC................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................CCAGGACAGGTGGAAGAATGGGGCG.................................................................................................. | 25 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGCCAGGACAGGTGGA............................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................TGCCAGGACAGGTGGAAGAATGA...................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................TGAGTGCCAGGACAGGTGGAAGAAT........................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................CCGGATCTTCTCGGGGAATA.............................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ......................TGAGCTGAAGAACCGGAGCTC......................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGAGTGCCAGGACAGGTGGAAA........................................................................................................... | 23 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................TGAGCTGAAGAACCGGATCTT......................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ............................................................GGACAGGTGGAAGAATGGGGC................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGCCAGGACAGGTGGAAGAATGGGG.................................................................................................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................GCCAGGACAGGTGGAAGAATGG...................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTG............................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGA.......................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................GGGGCAGGGCCAGAACTCTG.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................GGATCTTCTCGGGGGAAA.............................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGAGTGCCAGGACAGAAG............................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAATG....................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................AGCTGAAGAACCGGATCTTCTC...................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .......................................................TGCCAGGACAGGTGGAAGAAT........................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ....................................................................................................................................................CGGCGCGAGGCCTGG................. | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCCAGGACAGGTGGAAGAATGT...................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............GCAGGTCCCTGAGCTGAAGAACCGGATCT.......................................................................................................................................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................TCCCTGAGCTGAAGAACCGGA............................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................CAGGACAGGTGGAAGAATGG...................................................................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| ......................................................GTGCCAGGACAGGTGGA............................................................................................................. | 17 | 3 | 0.33 | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AAGGTCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGTGAGTGCCAGGACAGGTGGAAGAATGGGGCAGGGCCAGAACAAGGCCCCACTGAGCTGCCTGCCCTCCTGCACCCCCAGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTAGGGTA ......................................................((.(((...............))).)).(((((.......)))))................................................................................. ..................................................51..............................................99................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038854(GSM458537) MM653. (cell line) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR191525(GSM715635) 121genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577738(Rovira) total RNA. (breast) | SRR029131(GSM416760) MCF7. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................ACCCCCGAGAAGATCCGGTTCTT................................................................................................................................ | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CCACTGAGCTGCCTGCCCTAG............................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................TGGAAGAATGGGGCAGGGC.............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................GCCCTCCTGCACCCCCG................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................CCCTGAGCTGAAGAACCATC............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |