| (2) AGO2.ip | (5) B-CELL | (2) BRAIN | (4) BREAST | (13) CELL-LINE | (3) CERVIX | (4) HEART | (1) HELA | (6) LIVER | (1) OTHER | (20) SKIN | (4) UTERUS | (1) XRN.ip |
| CCACGCCCGTGACGGCAGCATCCTGGCTGGCTCCTGCCTCTATGTTGGCCGTAAGTTGGCACCCAGGACACCCCAGGGGTAGCTCTTGGGAGCGGCATCTCCCTCTGGAGTGAGGCATGAATTGTGGGCCTTCTGGCCTGGGGATGAGCTGTGGGCACACTGGCATGGCTATGCAGGTCTTTCAGGTGGGAATGAGAACCTGGAGACCCGGTCGGGCAAGGTGGCTCATGTCTGTAAGCCCAGCACTTTG ..............................................................................((.((((.....(((..((((((((((......)))...........(((((....)))))))))))).)))..))))))............................................................................................ ..........................................................................75....................................................................................161....................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR343336 | SRR343337 | SRR343334 | SRR343335 | SRR189785 | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR189784 | SRR189782 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189787 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR040008(GSM532893) G727N. (cervix) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR191461(GSM715571) 35genomic small RNA (size selected RNA from t. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM359177(GSM359177) hela_nucl_a. (hela) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR040029(GSM532914) G026T. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR040024(GSM532909) G613N. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................GGGGATGAGCTGTGGATA............................................................................................. | 18 | 206.00 | 0.00 | 51.00 | 44.00 | 43.00 | 19.00 | 18.00 | 6.00 | 8.00 | - | 1.00 | - | - | - | 3.00 | 1.00 | 1.00 | 2.00 | - | 1.00 | 2.00 | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGAT.............................................................................................. | 17 | 200.00 | 0.00 | 79.00 | 40.00 | 34.00 | 20.00 | 11.00 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGATAG............................................................................................ | 19 | 91.00 | 0.00 | 16.00 | 13.00 | 18.00 | 6.00 | 2.00 | 20.00 | - | 3.00 | 2.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................GGGATGAGCTGTGGGTAGG........................................................................................... | 19 | 10.00 | 0.00 | - | 3.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................CATCCTGGCTGGCTCGCCA..................................................................................................................................................................................................................... | 19 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGGTAGG........................................................................................... | 20 | 7 | 3.43 | 1.57 | - | - | - | - | - | 1.00 | - | 0.29 | 0.71 | - | - | - | 0.14 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | 0.14 | 0.14 | - | 0.14 | - | 0.14 | - | 0.14 | 0.14 | 0.14 | - |
| ............................................................................................................................................GGGATGAGCTGTGGGTA............................................................................................. | 17 | 3.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGTTA............................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGGCAGGG.......................................................................................... | 21 | 2.00 | 0.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGATG............................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................TAGCTCTTGGGAGCGGGC......................................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGG............................................................................................... | 16 | 7 | 1.57 | 1.57 | - | - | - | 0.14 | 0.29 | - | - | - | 0.14 | - | - | - | - | - | - | 0.29 | - | 0.14 | - | - | - | - | - | - | 0.14 | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................GGGGATGAGCTGTGGGTAG............................................................................................ | 19 | 7 | 1.43 | 1.57 | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.43 | 0.14 | 0.14 | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - |
| ...........................................................................................................................................GGGGATGAGCTGTGGGTA............................................................................................. | 18 | 7 | 1.29 | 1.57 | - | 0.14 | - | - | - | 0.29 | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | 0.14 | - | 0.14 | - | - | - | - | - | 0.14 |
| ...........................................................................................................................................GGGGATGAGCTGTGGATAA............................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................GGGATGAGCTGTGGGCAGGG.......................................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGATGG............................................................................................ | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................CGGGCAAGGTGGCTCGG..................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGAG.............................................................................................. | 17 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................AACCTGGAGACCCGGGT..................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................TAGCTCTTGGGAGCGGGCGG....................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGAC.............................................................................................. | 17 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................GCATCCTGGCTGGCTCCTGCCTCTAT............................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................AACCTGGAGACCCGGTCTCGT................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGGCAGG........................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................CGGGCAAGGTGGCTCGGGG................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........GACGGCAGCATCCTGGCTGGCTCCT....................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................TAGCTCTTGGGAGCGATC......................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................TCCTGGCTGGCTCCTCA..................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGGCAGGGG......................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGTTAG............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................GAGAACCTGGAGACCGACC...................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................TGGGGATGAGCTGTGG................................................................................................ | 16 | 4 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | 0.25 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................TGGGGATGAGCTGTGGGTA............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................GGGGATGAGCTGTGGTT.............................................................................................. | 17 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................TGGGGATGAGCTGTGGAT.............................................................................................. | 18 | 4 | 0.50 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................TGGGGATGAGCTGTGGA............................................................................................... | 17 | 4 | 0.50 | 1.00 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................TGGGGATGAGCTGTGGATAG............................................................................................ | 20 | 4 | 0.25 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................TGGGGATGAGCTGTGGATA............................................................................................. | 19 | 4 | 0.25 | 1.00 | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................CGGTCGGGCAAGGTGGC......................... | 17 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................GGGGATGAGCTGTGGGGAG............................................................................................ | 19 | 7 | 0.14 | 1.57 | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CCACGCCCGTGACGGCAGCATCCTGGCTGGCTCCTGCCTCTATGTTGGCCGTAAGTTGGCACCCAGGACACCCCAGGGGTAGCTCTTGGGAGCGGCATCTCCCTCTGGAGTGAGGCATGAATTGTGGGCCTTCTGGCCTGGGGATGAGCTGTGGGCACACTGGCATGGCTATGCAGGTCTTTCAGGTGGGAATGAGAACCTGGAGACCCGGTCGGGCAAGGTGGCTCATGTCTGTAAGCCCAGCACTTTG ..............................................................................((.((((.....(((..((((((((((......)))...........(((((....)))))))))))).)))..))))))............................................................................................ ..........................................................................75....................................................................................161....................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR343336 | SRR343337 | SRR343334 | SRR343335 | SRR189785 | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR189784 | SRR189782 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189787 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR040008(GSM532893) G727N. (cervix) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR191461(GSM715571) 35genomic small RNA (size selected RNA from t. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | GSM359177(GSM359177) hela_nucl_a. (hela) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR040029(GSM532914) G026T. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR040024(GSM532909) G613N. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................................................................................GGCAAGGTGGCTCATGTCTGTAGGCC.......... | 26 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................AGGTGGGAATGAGAAAGGT................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................TCCCTCTGGAGTGAGCAGA.................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................GTCTGTAAGCCCAGCACTGAGC | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................AGGACACCCCAGGGGTTG........................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................................CTGTAAGCCCAGCACTCGAG | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGCCACCTTGCCCGACCGGGTCTCCAGG........................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |