| (1) BRAIN | (10) BREAST | (6) CELL-LINE | (3) CERVIX | (2) FIBROBLAST | (2) HEART | (1) HELA | (1) LIVER | (1) OTHER | (65) SKIN |
| CTCCCAGATCGCAGAGCGAGAGGACCATGTGTTGGTTGAAGATGTGCGGGGTGAGTCTGAGGCTGTCCCTGCAGGTTGTGAACTCCTGGCCTCTGGGAAGAGGCTCAGCTGGACTTCCAGAACCAGGTATGAGGGGGTGCCTGGGGCTGGGAGCCTGCACTGCACTCACTGATGAAAGAGCTTCTGACATGCTGACCATGGCTCCTTCTGGCTCAAGTCTCCTGGGGCTGGTTGGAGCTTGGGGCCTGGA .............................................................................(((...((((((...))))))((((((((.((.((.(((((((..((((((((......))))))))..))))))))).)).......(((....)))..))))))))..)))............................................................ ............................................................................77..................................................................................................................193....................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | GSM532878(GSM532878) G691T. (cervix) | SRR191478(GSM715588) 30genomic small RNA (size selected RNA from t. (breast) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | GSM359175(GSM359175) hela_5_pct. (hela) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | GSM339994(GSM339994) hues6. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast) | SRR038859(GSM458542) MM386. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330918(SRX091756) tissue: normal skindisease state: normal. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR191572(GSM715682) 66genomic small RNA (size selected RNA from t. (breast) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGACA............................................................. | 25 | 1 | 834.00 | 834.00 | 86.00 | 64.00 | 50.00 | 48.00 | 43.00 | 39.00 | 47.00 | 36.00 | 29.00 | 30.00 | 25.00 | 23.00 | 20.00 | 17.00 | 16.00 | 13.00 | 10.00 | 12.00 | 12.00 | 8.00 | 8.00 | 10.00 | 8.00 | 10.00 | 10.00 | 6.00 | 8.00 | 7.00 | 6.00 | 8.00 | 5.00 | 5.00 | 7.00 | 7.00 | 3.00 | 4.00 | 3.00 | 2.00 | 4.00 | 5.00 | 2.00 | 2.00 | 4.00 | 4.00 | 3.00 | 4.00 | 2.00 | 2.00 | 3.00 | 4.00 | 3.00 | 1.00 | 3.00 | 2.00 | 2.00 | 2.00 | 3.00 | 3.00 | 2.00 | 2.00 | 2.00 | 2.00 | - | 2.00 | 2.00 | - | 1.00 | 2.00 | - | 2.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGACA............................................................. | 26 | 1 | 151.00 | 151.00 | 15.00 | 10.00 | 10.00 | 7.00 | 7.00 | 6.00 | - | 4.00 | 7.00 | 3.00 | 4.00 | 4.00 | 4.00 | 5.00 | 4.00 | 1.00 | 4.00 | - | 1.00 | 4.00 | 3.00 | 1.00 | 3.00 | 1.00 | - | 2.00 | - | 2.00 | 2.00 | - | 3.00 | 2.00 | 1.00 | 1.00 | 3.00 | 1.00 | 2.00 | 5.00 | 2.00 | 1.00 | - | 2.00 | 1.00 | 1.00 | 2.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGAC.............................................................. | 24 | 1 | 11.00 | 11.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGACATGC.......................................................... | 29 | 1 | 3.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGA............................................................... | 23 | 1 | 3.00 | 3.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGATA............................................................. | 25 | 1 | 2.00 | 3.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................ACTCCTGGCCTCTGGGGAC...................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGACATGC.......................................................... | 28 | 1 | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGAC.............................................................. | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................ACTGATGAAAGAGCTTCTGACA............................................................. | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGACC............................................................. | 25 | 1 | 1.00 | 11.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGACATG........................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................CTGCAGGTTGTGAACGGT.................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................TGTGTTGGTTGAAGAGCG............................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................CACTGATGAAAGAGCTTCTGACATGCTGACC..................................................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGACATGCTG........................................................ | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................AGTCTCCTGGGGCTGAGGT................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................AGGCTGTCCCTGCAGGTTGTG.......................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................TGGACTTCCAGAACCAGGTATGAGGGGGA................................................................................................................ | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................ACTGATGAAAGAGCTTCTGACATGCTGACC..................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................TGTTGGTTGAAGATGTGCGG......................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTG................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ..........................................................................................................................................................................GATGAAAGAGCTTCTGACA............................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGACATGCT......................................................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................CACTGATGAAAGAGCTTCTGACA............................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................AGGTTGTGAACTCCTGGC................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................CTCACTGATGAAAGAGCTTCTGAAA............................................................. | 25 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................ACTCACTGATGAAAGAGCTTCTGACAT............................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................CGAGAGGACCATGTGT.......................................................................................................................................................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................AGCTGGACTTCCAGAACCAGGT.......................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................CTGTCCCTGCAGGTTGTGAACTCCTG.................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................GTTGAAGATGTGCGGGGTGAGTCTGA.............................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................GCTCAAGTCTCCTGGAA....................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................CACTCACTGATGAAAGAGCTTCTGACA............................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................TCACTGATGAAAGAGCTTCTGACA............................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................ATGTGTTGGTTGAAGATGTGCG.......................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CACTCACTGATGAAAGAGCTTCTGACATGC.......................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................GTGTTGGTTGAAGATGTGCGGG........................................................................................................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 |
| CTCCCAGATCGCAGAGCGAGAGGACCATGTGTTGGTTGAAGATGTGCGGGGTGAGTCTGAGGCTGTCCCTGCAGGTTGTGAACTCCTGGCCTCTGGGAAGAGGCTCAGCTGGACTTCCAGAACCAGGTATGAGGGGGTGCCTGGGGCTGGGAGCCTGCACTGCACTCACTGATGAAAGAGCTTCTGACATGCTGACCATGGCTCCTTCTGGCTCAAGTCTCCTGGGGCTGGTTGGAGCTTGGGGCCTGGA .............................................................................(((...((((((...))))))((((((((.((.((.(((((((..((((((((......))))))))..))))))))).)).......(((....)))..))))))))..)))............................................................ ............................................................................77..................................................................................................................193....................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR191605(GSM715715) 76genomic small RNA (size selected RNA from t. (breast) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | GSM532878(GSM532878) G691T. (cervix) | SRR191478(GSM715588) 30genomic small RNA (size selected RNA from t. (breast) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | GSM359175(GSM359175) hela_5_pct. (hela) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | GSM339994(GSM339994) hues6. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR191597(GSM715707) 75genomic small RNA (size selected RNA from t. (breast) | SRR038859(GSM458542) MM386. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330918(SRX091756) tissue: normal skindisease state: normal. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR191572(GSM715682) 66genomic small RNA (size selected RNA from t. (breast) | SRR191615(GSM715725) 94genomic small RNA (size selected RNA from t. (breast) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................CATGGTCAGCATGTCAGAAGC.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................AGCATGTCAGAAGCTCTT......................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .............................................................................................................CATACCTGGTTCTGGAAGTCCA....................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| .........................................................................................................................................TGCCTGGGGCTGGGAGCCTTT............................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |