| (1) AGO2.ip | (1) B-CELL | (1) BRAIN | (4) BREAST | (11) CELL-LINE | (3) CERVIX | (2) HEART | (1) HELA | (10) LIVER | (1) OTHER | (1) RRP40.ip | (11) SKIN |
| CTCAGCGGAATCCCCTGCGTTCAGTAGCCCCGCTCTCCCCTGTCCCGAAGGTTGGTCTCGTCTCGCGCGGCCCTCCCTCCAGGGCACCACCTGGCTCCCCACGCCTTTTAACTTCAGCAAACGGCACTAGATTTACCCCCTGACTATCCCAGATTTCCCCCAGAAATTACTGGAAAACGACATCCCCCGTCCCTTTCTCCAGGGGATCTCTCTGAAATCTCCTTCGGGCAACGCTAGCTACAAACGGAGA ...................................................(((((.((((...((...(((((......))))).......(((.......)))...........))..)))).)))))........................................................................................................................ ..................................................51..................................................................................135................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM339996(GSM339996) hues6Neuron. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | GSM532876(GSM532876) G547T. (cervix) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM532874(GSM532874) G699T. (cervix) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR029126(GSM416755) 143B. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | GSM532880(GSM532880) G659T. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR191413(GSM715523) 28genomic small RNA (size selected RNA from t. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................GTCTCGTCTCGCGCGCGTC................................................................................................................................................................................. | 19 | 1 | 25.00 | 5.00 | 8.00 | 1.00 | - | 4.00 | 2.00 | - | 3.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGCGT.................................................................................................................................................................................. | 18 | 1 | 8.00 | 5.00 | 2.00 | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................GCAAACGGCACTAGATTTA................................................................................................................... | 19 | 1 | 7.00 | 7.00 | - | - | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGCG................................................................................................................................................................................... | 17 | 1 | 6.00 | 5.00 | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCG..................................................................................................................................................................................... | 15 | 1 | 5.00 | 5.00 | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGC.................................................................................................................................................................................... | 16 | 1 | 4.00 | 5.00 | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGCGTG................................................................................................................................................................................. | 19 | 1 | 2.00 | 5.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................ATCTCCTTCGGGCAACGCTAGC............ | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGCTTC................................................................................................................................................................................. | 19 | 1 | 2.00 | 5.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................CTCCCCTGTCCCGAAGGTTGG................................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................GGTCTCGTCTCGCGCGCGT.................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................GTCTCGTCTCGCGCGCATC................................................................................................................................................................................. | 19 | 1 | 1.00 | 5.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................TTCAGCAAACGGCACTAGAT...................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................AGATTTACCCCCTGACTATCC..................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGTTT.................................................................................................................................................................................. | 18 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................AGGGCACCACCTGGCTCCCC...................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTCTCGTCTCGCGCGCATA................................................................................................................................................................................. | 19 | 1 | 1.00 | 5.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................CAGAAATTACTGGAAAACGACATCCCCCG............................................................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................CCCTTTCTCCAGGGGATCTCTCTGAA.................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ...............TGCGTTCAGTAGCCCCGC......................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................TTAACTTCAGCAAACGGC............................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................CCAGAAATTACTGGAAAAC........................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................TCTCGTCTCGCGCGGG................................................................................................................................................................................... | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................TCCCTCCAGGGCACCCA................................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CTCAGCGGAATCCCCTGCGTTCAGTAGCCCCGCTCTCCCCTGTCCCGAAGGTTGGTCTCGTCTCGCGCGGCCCTCCCTCCAGGGCACCACCTGGCTCCCCACGCCTTTTAACTTCAGCAAACGGCACTAGATTTACCCCCTGACTATCCCAGATTTCCCCCAGAAATTACTGGAAAACGACATCCCCCGTCCCTTTCTCCAGGGGATCTCTCTGAAATCTCCTTCGGGCAACGCTAGCTACAAACGGAGA ...................................................(((((.((((...((...(((((......))))).......(((.......)))...........))..)))).)))))........................................................................................................................ ..................................................51..................................................................................135................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM339996(GSM339996) hues6Neuron. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | GSM532876(GSM532876) G547T. (cervix) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM532874(GSM532874) G699T. (cervix) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR029126(GSM416755) 143B. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | GSM532880(GSM532880) G659T. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | GSM339994(GSM339994) hues6. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR191413(GSM715523) 28genomic small RNA (size selected RNA from t. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................CTGACTATCCCAGATCGG............................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................TGGGATAGTCAGGGGGT................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................TCGGGACAGGGGAGAGC.......................................................................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................GGGATAGTCAGGGGGT.................................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................TCTGGGATAGTCAGGGGGTAA................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................TCTGGGATAGTCAGGGGGT................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................GCCCCGCTCTCCCCTGGA.............................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................GTTTGTAGCTAGCGTTG..... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ............................................................................................................................................................................GAAAACGACATCCCCTTCT........................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................CCCTGACTATCCCAGATC............................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| .................................TCTCCCCTGTCCCGAAGGCA..................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................CCCCGCTCTCCCCTGGCTG............................................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................GCCCCGCTCTCCCCTGGGA............................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................CATCCCCCGTCCCTTGC..................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.25 | - | - | - | - | |
| ............................................................................................................................................................................GAAAACGACATCCCCTGG............................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................................GTAGCTAGCGTTGCCCGA......... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................CATCCCCCGTCCCTTGAC.................................................... | 18 | 0.50 | 0.00 | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................AAGGGACGGGGGATG....................................................... | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - |
| ....................................................................................................................................................................................CATCCCCCGTCCCTTGCC.................................................... | 18 | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | |
| ....................................................................................................................................................................................CATCCCCCGTCCCTTGAG.................................................... | 18 | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | |
| ....................................................................................................................................................................................CATCCCCCGTCCCTTGCCT................................................... | 19 | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |