| (9) BREAST | (14) CELL-LINE | (13) CERVIX | (8) HEART | (4) LIVER | (2) OTHER | (1) RRP40.ip | (16) SKIN | (4) UTERUS | (1) XRN.ip |
| TCTATCTCCATTTCTTAACCTGCATCATTTTTCTCCATAGCATTTATCATCTCTGTTTTGTTTGGTTCACTAGCACATACTCAAAGGTGCCAGGCATGCAGTAGGTGCTCAGTAAATATTGTTTAAATGAGTGGATGCATGAATAAAAAAGAGAATTATAGGAAATAGGTCAATTAAACGCCTCTCATTTTTCTCCTTAGCAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCAC ..................................................((((((..(((((((..((((..............))))))))))).)))).))..(((((.(((((...)))))..)))))...................................................................................................................... ..................................................51...............................................................................132.................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040011(GSM532896) G529T. (cervix) | SRR040031(GSM532916) G013T. (cervix) | GSM532890(GSM532890) G576T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR040024(GSM532909) G613N. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR189784 | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM532883(GSM532883) G871N. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | TAX577579(Rovira) total RNA. (breast) | GSM532887(GSM532887) G761N. (cervix) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR191523(GSM715633) 107genomic small RNA (size selected RNA from . (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | GSM532880(GSM532880) G659T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | GSM532879(GSM532879) G659N. (cervix) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR029131(GSM416760) MCF7. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR040015(GSM532900) G623T. (cervix) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................GTAAATATTGTTTAACC.......................................................................................................................... | 17 | 229.00 | 0.00 | 66.00 | 36.00 | 30.00 | 17.00 | 13.00 | 10.00 | 8.00 | 8.00 | - | 1.00 | - | 4.00 | - | 5.00 | 3.00 | 5.00 | 4.00 | - | - | 2.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | |
| ...............................................................................................................GTAAATATTGTTTAACCA......................................................................................................................... | 18 | 36.00 | 0.00 | - | 1.00 | 3.00 | - | - | - | - | 1.00 | 2.00 | 5.00 | 2.00 | - | - | - | 1.00 | - | - | 2.00 | 2.00 | 1.00 | 2.00 | 1.00 | 2.00 | 2.00 | - | - | - | 1.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | |
| ...............................................................................................................GTAAATATTGTTTAACCAA........................................................................................................................ | 19 | 16.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | |
| ..............................................................................................................AGTAAATATTGTTTAACC.......................................................................................................................... | 18 | 10.00 | 0.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GTAAATATTGTTTAACA.......................................................................................................................... | 17 | 8.00 | 0.00 | - | - | - | - | - | - | - | - | 3.00 | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GTAAATATTGTTTAACCAC........................................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................TTTCTCCATAGCATTGTTC.......................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................AGTAAATATTGTTTAACA.......................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GTAAATATTGTTTAAATAAAA...................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................ACTCAAAGGTGCCAGGCATGCAGTAG.................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................GGATGCATGAATAAAAAAG................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................GTAAATATTGTTTAACAAA........................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................TGTTTTGTTTGGTTCCGTT.................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................AGCAAGACCCCCCTGCCAAGTG.... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....TCTCCATTTCTTAACCTTTTG................................................................................................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................TGATATGAAAAAGGAGCAAGACCCCCCTGCC......... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................TATGAAAAAGGAGCAAGACCCCC.............. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................TGATATGAAAAAGGAGCAAGAC.................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................GTAAATATTGTTTAACCC......................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................AAAAGGAGCAAGACCCCCCTGC.......... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................AGTAAATATTGTTTAACCA......................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GTAAATATTGTTTAACCCA........................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ......................................................................................................................TTGTTTAAATGAGTGGATGCA............................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................AGTAAATATTGTTTAACCAA........................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........TTTCTTAACCTGCATCATTTT........................................................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................AGTAAATATTGTTTAAAC.......................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................ACCCCCCTGCCAAGTGC... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................ATCATCTCTGTTTTGTTTG.......................................................................................................................................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| TCTATCTCCATTTCTTAACCTGCATCATTTTTCTCCATAGCATTTATCATCTCTGTTTTGTTTGGTTCACTAGCACATACTCAAAGGTGCCAGGCATGCAGTAGGTGCTCAGTAAATATTGTTTAAATGAGTGGATGCATGAATAAAAAAGAGAATTATAGGAAATAGGTCAATTAAACGCCTCTCATTTTTCTCCTTAGCAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCAC ..................................................((((((..(((((((..((((..............))))))))))).)))).))..(((((.(((((...)))))..)))))...................................................................................................................... ..................................................51...............................................................................132.................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040011(GSM532896) G529T. (cervix) | SRR040031(GSM532916) G013T. (cervix) | GSM532890(GSM532890) G576T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR040024(GSM532909) G613N. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR189784 | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM532883(GSM532883) G871N. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | TAX577579(Rovira) total RNA. (breast) | GSM532887(GSM532887) G761N. (cervix) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR191523(GSM715633) 107genomic small RNA (size selected RNA from . (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | GSM532880(GSM532880) G659T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | GSM532879(GSM532879) G659N. (cervix) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR029131(GSM416760) MCF7. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR040015(GSM532900) G623T. (cervix) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................AAAAAGAGAATTATAGCTTT..................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................AAAGAGAATTATAGGCCC..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................AAAAAAGAGAATTATAGGTTG..................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................AAAAAAGAGAATTATAGGTTTG.................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................AGAAAAATGATGCAGGTT........................................................................................................................................................................................................................ | 18 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |