| (1) AGO2.ip | (3) BRAIN | (3) BREAST | (17) CELL-LINE | (1) CERVIX | (3) HEART | (2) HELA | (1) LIVER | (2) OTHER | (62) SKIN | (1) TESTES |
| GTGTGTGTGTGTGTGTGTGTGTAGAGAGAGAGAGAGAGAGAGAAAATGAGATTGAGAATCCTCCTTCTTCATACTCGAACCAAGAAAGAGTATCCTGGGGTTTGGGACTGGGATCCCGAGGCCGAGTCCCGCCCTCACTCTGGTTTTAAAGTTGAGAATGCAGTATCTCTTGGTATCTCCAGAACGGATTCCTTCCCTAGGTGTAGGGTGGGCCGGCAAAGTCAACCGGCCGCTCTGGATCATCTGGGAA .......................................................................................................((((((.((.((....)))).))))))...((((..((........)).)))).............................................................................................. .......................................................................................................104.................................................................172............................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR343337 | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343335 | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM532876(GSM532876) G547T. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343336 | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191634(GSM715744) 98genomic small RNA (size selected RNA from t. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038862(GSM458545) MM472. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................................TGGGATCCCGAGGCC............................................................................................................................... | 15 | 3 | 140.00 | 140.00 | 29.33 | - | 5.33 | 5.00 | 4.67 | 4.67 | 4.33 | 3.67 | 3.67 | 3.33 | 3.00 | 3.00 | 3.00 | 3.00 | 2.00 | 2.67 | 2.67 | 2.67 | 2.67 | 2.33 | 2.33 | 2.33 | 0.67 | 2.33 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 0.67 | - | 1.33 | 1.00 | 0.33 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 0.67 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | 1.00 | 0.67 | - | 1.00 | - | - | - | - | - | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.67 | 0.33 | - | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 |
| ....................GTAGAGAGAGAGAGAGGATC.................................................................................................................................................................................................................. | 20 | 19.00 | 0.00 | - | 19.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................AATGAGATTGAGAATC.............................................................................................................................................................................................. | 16 | 4 | 5.25 | 5.25 | - | 5.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCC.............................................................................................................................. | 16 | 3 | 1.67 | 140.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCA.............................................................................................................................. | 16 | 3 | 1.00 | 140.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................AAAGTTGAGAATGCAGTGAGA.................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................CTAGGTGTAGGGTGGGAAAG.................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................TGGGATCCCGAGGCCGAGG........................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................GGGATCCCGAGGCCGCT............................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................GGGATCCCGAGGCCGCTC........................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................GTGTAGGGTGGGCCGGCAAAGTCA.......................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CTGGGATCCCGAGGCC............................................................................................................................... | 16 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................TTCCCTAGGTGTAGGGTGGGCCAT.................................. | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................TAGGTGTAGGGTGGGCCGTCA................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................CAAGAAAGAGTATCCTGGGGTT.................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCGCTCC.......................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................GTGTAGGGTGGGCCGGCAAAGT............................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CTGGGATCCCGAGGC................................................................................................................................ | 15 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCCC............................................................................................................................. | 17 | 3 | 0.33 | 140.00 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCCCT............................................................................................................................ | 18 | 3 | 0.33 | 140.00 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCAC............................................................................................................................. | 17 | 3 | 0.33 | 140.00 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCCCTC........................................................................................................................... | 19 | 3 | 0.33 | 140.00 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCACTC........................................................................................................................... | 19 | 3 | 0.33 | 140.00 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TGGGATCCCGAGGCCCA............................................................................................................................. | 17 | 3 | 0.33 | 140.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GTGTGTGTGTGTGTGTGTGTGTAGAGAGAGAGAGAGAGAGAGAAAATGAGATTGAGAATCCTCCTTCTTCATACTCGAACCAAGAAAGAGTATCCTGGGGTTTGGGACTGGGATCCCGAGGCCGAGTCCCGCCCTCACTCTGGTTTTAAAGTTGAGAATGCAGTATCTCTTGGTATCTCCAGAACGGATTCCTTCCCTAGGTGTAGGGTGGGCCGGCAAAGTCAACCGGCCGCTCTGGATCATCTGGGAA .......................................................................................................((((((.((.((....)))).))))))...((((..((........)).)))).............................................................................................. .......................................................................................................104.................................................................172............................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR343337 | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343335 | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM532876(GSM532876) G547T. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343336 | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191634(GSM715744) 98genomic small RNA (size selected RNA from t. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038862(GSM458545) MM472. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........GTGTGTGTGTGTGTAGACAG.............................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................CGAACCAAGAAAGAGGTG............................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....GTGTGTGTGTGTGTGTGTAGAGTCT............................................................................................................................................................................................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................GAACCAAGAAAGAGTATGG........................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................TTCCCAGATGATCCAGAGCGGCCGGT | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................CGAACCAAGAAAGAGTTG............................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................GTGTGTAGAGAGAGACGCC....................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................AGAGAGAGAGAAAATGATG....................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................ATGAAGAAGGAGGATTCT.................................................................................................................................................................................. | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |