| (6) B-CELL | (1) BRAIN | (2) BREAST | (23) CELL-LINE | (2) CERVIX | (3) HEART | (2) HELA | (4) LIVER | (2) OTHER | (12) SKIN | (2) UTERUS | (1) XRN.ip |
| CAGGAGAGCGGGCGCAAGAAAGTGACGGCCGTGCACAAGGCCAACATCATGTATGTCCCCTGACCTCTCTGCGAGCAGTCCAGAAGCAGCTGCAGTGGCCTGCTTGGGCCTGCTCTGAGGGATTTGTGGTCCAAAAGCCCAGCTACCCACCGAGGTGCCACCCTAGGCGAGTGCCCTGTTGCCCTCGAGGCCTTGCCAGAACCCACACTTAGGGGAGGTGGGGTGGGATTCTGTCCATTTTGCTGGTGAGGGACAGGTTAGAATTCAGACCCCAGCCTCCTGGGGCCCTCTGCACGCCCCGTCCCTCTGGCTGACTGTTGCGATGGCCAAGCTGGTGTCCTATTCCTAACCCCCCACCAGGAAACTGGGCGATGGGCTTTTCCTCCAGTGCTGCAGGGAGGTGGCAGCCC .............................................................................................................................................................................................................(((((.....)))))((((.....(((((((.((........)).))))))).....))))................................................................................................................................................ .............................................................................................................................................................................................................206.............................................................270.......................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR207110(GSM721072) Nuclear RNA. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR343334 | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR040029(GSM532914) G026T. (cervix) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR029128(GSM416757) H520. (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTA................................................................................................................................................ | 18 | 1 | 41.00 | 3.00 | 22.00 | - | 2.00 | 2.00 | 1.00 | - | 1.00 | 3.00 | - | - | 2.00 | - | - | 1.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTAT............................................................................................................................................... | 19 | 1 | 30.00 | 3.00 | 9.00 | - | 3.00 | - | 1.00 | - | 1.00 | - | 3.00 | - | - | - | - | - | - | 2.00 | - | 1.00 | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTATC.............................................................................................................................................. | 20 | 1 | 17.00 | 3.00 | 3.00 | 8.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................................................GGGACAGGTTAGAATTA................................................................................................................................................ | 17 | 10.00 | 0.00 | 4.00 | - | 1.00 | - | - | 3.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................................GGGACAGGTTAGAATTAT............................................................................................................................................... | 18 | 5.00 | 0.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................................GGGACAGGTTAGAATTATC.............................................................................................................................................. | 19 | 3.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATT................................................................................................................................................. | 17 | 1 | 3.00 | 3.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................................................................................................................................GAAACTGGGCGATGGGCTTTTCCTCC........................ | 26 | 1 | 3.00 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................................................................................................................................................................................TCCTCCAGTGCTGCAAAG............ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTAAA.............................................................................................................................................. | 20 | 1 | 2.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTATCC............................................................................................................................................. | 21 | 1 | 2.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................................GAGGGACAGGTTAGAATTATC.............................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................................................................................................................................GAAACTGGGCGATGGGCTT............................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .AGGAGAGCGGGCGCAAGAAAGTGACG............................................................................................................................................................................................................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAAGAA................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAATTATAA............................................................................................................................................. | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................AGGGGAGGTGGGGTGGGATT.................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................................................GGGACAGGTTAGAATTATA.............................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ..................................................................................................................................................................................................................AGGGGAGGTGGGGTGCAT...................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................AGGGGAGGTGGGGTGGGAAGGC.................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................................................................................................................................................ACTGGGCGATGGGCTTTTC............................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................................AGGGACAGGTTAGAAAGAA............................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................................................................................CGCCCCGTCCCTCTGCTCT................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................................................................................................................................................AAACTGGGCGATGGGCTTTTCC........................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .........GGGCGCAAGAAAGTGACGGCCG........................................................................................................................................................................................................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................AAGTGACGGCCGTGCACAAGG.................................................................................................................................................................................................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...GAGAGCGGGCGCAAGAAAGTG.................................................................................................................................................................................................................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................TTAGGGGAGGTGGGGTTTT....................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................AGCAGTCCAGAAGCAGCTGC............................................................................................................................................................................................................................................................................................................................. | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| CAGGAGAGCGGGCGCAAGAAAGTGACGGCCGTGCACAAGGCCAACATCATGTATGTCCCCTGACCTCTCTGCGAGCAGTCCAGAAGCAGCTGCAGTGGCCTGCTTGGGCCTGCTCTGAGGGATTTGTGGTCCAAAAGCCCAGCTACCCACCGAGGTGCCACCCTAGGCGAGTGCCCTGTTGCCCTCGAGGCCTTGCCAGAACCCACACTTAGGGGAGGTGGGGTGGGATTCTGTCCATTTTGCTGGTGAGGGACAGGTTAGAATTCAGACCCCAGCCTCCTGGGGCCCTCTGCACGCCCCGTCCCTCTGGCTGACTGTTGCGATGGCCAAGCTGGTGTCCTATTCCTAACCCCCCACCAGGAAACTGGGCGATGGGCTTTTCCTCCAGTGCTGCAGGGAGGTGGCAGCCC .............................................................................................................................................................................................................(((((.....)))))((((.....(((((((.((........)).))))))).....))))................................................................................................................................................ .............................................................................................................................................................................................................206.............................................................270.......................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR207110(GSM721072) Nuclear RNA. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR343334 | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR040029(GSM532914) G026T. (cervix) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR029128(GSM416757) H520. (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | TAX577744(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................................................GGGGAGGTGGGGTGGGAGCGC.................................................................................................................................................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................AAAAGCCCAGCTACCCATTT.................................................................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................................................................................................GGCTGACTGTTGCGATGGCGGAG............................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................GGGGAGGTGGGGTGGGGCGC................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................................................................................GCACGCCCCGTCCCTTGC..................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................GGGGAGGTGGGGTGGGGCG.................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................................................................................................................................................................ACCTCCCTGCAGCACTG........ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| .........................................................................................................................................CGGTGGGTAGCTGGG.................................................................................................................................................................................................................................................................. | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |