| (1) AGO2.ip | (5) B-CELL | (2) BRAIN | (5) BREAST | (18) CELL-LINE | (3) FIBROBLAST | (4) HEART | (1) LIVER | (2) OTHER | (39) SKIN | (1) XRN.ip |
| ATTTCCAAGGGTTTTTTTAAACCGCGTTACTATTATGTTTGACTAATTCTGAGCATTGGGCTGCAGAAGAATATTTTCTCCTGGGTTTTTACAAGTGATCTCATATTTTAAAGCCCAGCCTTCTTCAGGAACTGTGATTCTTTCAGGTATGACAGAAAACTGATTTGTACTAATTTTATTTTCCTTATGCATTTCTTAAGGTGGTAATTCGAAGATTACCTCCCACTTTGACCAAGGAGCAGCTTCAGGA ....................................................((((.((((((.(((((...........(((((((((.....(((....))).....))))))))).))))).)))...((((.((.((....)).)).))))...........................))).))))............................................................ ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR189782 | SRR189785 | TAX577741(Rovira) total RNA. (breast) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577742(Rovira) total RNA. (breast) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................TGGGCTGCAGAAGAATA................................................................................................................................................................................. | 17 | 2 | 86.50 | 86.50 | 18.50 | - | 7.00 | 3.50 | 3.50 | 2.50 | 1.50 | 2.50 | 2.00 | 2.00 | - | 1.00 | 2.00 | 1.00 | 1.00 | 2.00 | 2.00 | 1.50 | 1.50 | 1.50 | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 0.50 | 0.50 | 0.50 | - | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | - | - | - | - |
| ........................................................TGGGCTGCAGAAGAATAATC.............................................................................................................................................................................. | 20 | 2 | 9.00 | 86.50 | - | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................TGGGCTGCAGAAGAATAA................................................................................................................................................................................ | 18 | 2 | 3.00 | 86.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................TGGGCTGCAGAAGAAT.................................................................................................................................................................................. | 16 | 5 | 1.00 | 1.00 | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 |
| ....CCAAGGGTTTTTTTAACCC................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................TTTGACCAAGGAGCAGCTTC.... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................ATATTTTCTCCTGGGTTTTTACAAGTG......................................................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTCCTTATGCATTTCTTAAGTT................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................TTGGGCTGCAGAAGAATATTTTCTCCT........................................................................................................................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................ACCAAGGAGCAGCTTCAGGAACCT | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................AATTCTGAGCATTGGGCTGCAG........................................................................................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................TGACCAAGGAGCAGCCGG.... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TTTCCTTATGCATTTCTTAAGA................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................TGACCAAGGAGCAGCTGA.... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................CGAAGATTACCTCCCACTT...................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................TGAGCATTGGGCTGCAGAAGAATAT................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................TGACCAAGGAGCAGCTA..... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................GGTTTTTACAAGTGATCTCA................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................TGGGCTGCAGAAGAATAAA............................................................................................................................................................................... | 19 | 2 | 1.00 | 86.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................GGGCTGCAGAAGAATA................................................................................................................................................................................. | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TATTTTCCTTATGCATT......................................................... | 17 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.40 | - | - | - |
| ...........................................................................................................................................................................AATTTTATTTTCCTTATG............................................................. | 18 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - |
| ........................................................TGGGCTGCAGAAGAATC................................................................................................................................................................................. | 17 | 5 | 0.20 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ATTTCCAAGGGTTTTTTTAAACCGCGTTACTATTATGTTTGACTAATTCTGAGCATTGGGCTGCAGAAGAATATTTTCTCCTGGGTTTTTACAAGTGATCTCATATTTTAAAGCCCAGCCTTCTTCAGGAACTGTGATTCTTTCAGGTATGACAGAAAACTGATTTGTACTAATTTTATTTTCCTTATGCATTTCTTAAGGTGGTAATTCGAAGATTACCTCCCACTTTGACCAAGGAGCAGCTTCAGGA ....................................................((((.((((((.(((((...........(((((((((.....(((....))).....))))))))).))))).)))...((((.((.((....)).)).))))...........................))).))))............................................................ ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR189782 | SRR189785 | TAX577741(Rovira) total RNA. (breast) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR038863(GSM458546) MM603. (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577742(Rovira) total RNA. (breast) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............TTTAAACCGCGTTACCGA......................................................................................................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................ACCAAGGAGCAGCTTCATA. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................GTTCCTGAAGAAGGC...................................................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |