| (5) B-CELL | (5) BRAIN | (12) CELL-LINE | (3) HEART | (3) HELA | (7) LIVER | (2) OTHER | (1) RRP40.ip | (4) SKIN | (1) TESTES | (1) XRN.ip |
| AGTTTCTTTGGGGAGCTGCTGGGTCAGGAGATAGACCCGCTCAGGAATGTGCTGGTGACTGTTGGTGGCTATGGGGCCCTGTTCACAGCCTTCCAGGCCCTGGTGGACGAAGGAGACGAGGTGAGTGGGCAAGACTTGGGCTGAGTGGGACTGAGAGGTCAGGGCCATGCTGACTCCAGCTGATTTGACCCTTATATCAGGTCATCATCATCGAACCCTTTTTTGACTGCTACGAGCCCATGACAATGAT ...............................................(((.((..((.(((..((.((((.(((((..(((....)))..)))))))))))..))).))..))..))).................................................................................................................................... ............................................45.............................................................................124............................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189787 | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR189782 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................TGGACGAAGGAGACGAG.................................................................................................................................. | 17 | 1 | 33.00 | 33.00 | 15.00 | - | - | 4.00 | 2.00 | 1.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | - |
| ......................................................................................................GTGGACGAAGGAGACGAG.................................................................................................................................. | 18 | 1 | 7.00 | 7.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ...........................................GGAATGTGCTGGTGACTGTTGGTGG...................................................................................................................................................................................... | 25 | 1 | 3.00 | 3.00 | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................TGCTGGTGACTGTTGGTGGCT.................................................................................................................................................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| .......................................................................................................................................TTGGGCTGAGTGGGACT.................................................................................................. | 17 | 1 | 2.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................AGTGGGACTGAGAGGGAGC........................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................TTTGACTGCTACGAGCCCATGAC...... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................AATGTGCTGGTGACTGTTGGTGGC..................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GGCCCTGGTGGACGAAGGAGA...................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................CTGGTGACTGTTGGTGGCTATGGGGCCC........................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................TTTTTTGACTGCTACGAGCCCATA........ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................TTGACTGCTACGAGCCCAT......... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................AGTGGGACTGAGAGGTCAGGGCC.................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................TCAGGAATGTGCTGGTGACTGTTGG......................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGACGAAGGAGACGAGGTCATC............................................................................................................................ | 23 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................GAATGTGCTGGTGACTGTTGG......................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................CCCTTTTTTGACTGCTACGAGCCCA.......... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................TGCTGGTGACTGTTGGTGGCTATGGGGGG............................................................................................................................................................................ | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ................................................GTGCTGGTGACTGTTGGTTGCT.................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ...................................................CTGGTGACTGTTGGTGGCT.................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................CCCTGGTGGACGAAGGAGACG.................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................AGGCCCTGGTGGACGAAGGAGACGAGGTCAT............................................................................................................................. | 31 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................ACTGCTACGAGCCCATCTTG..... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GCTGGTGACTGTTGGTGGCTATGGGGCCCT.......................................................................................................................................................................... | 30 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................ACAGCCTTCCAGGCCCTAAC.................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GCTGGTGACTGTTGGTGGCT.................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................GTGCTGGTGACTGTTGGTGGCTATT................................................................................................................................................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................TCCAGGCCCTGGTGGACGAAGGAGACGAGGTC............................................................................................................................... | 32 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................GTGAGTGGGCAAGACTTGGGCTGAGTGGGACTGAGAGGTCAGGGCCATGCTGACTCCAGCTGATTTGACCCTTATATC.................................................... | 78 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................AGGAATGTGCTGGTGACTGTTGGTGG...................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................GTGGACGAAGGAGACGAGG................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................GGAATGTGCTGGTGACTGTTGGTGGCTATGGG............................................................................................................................................................................... | 32 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................CTTTTTTGACTGCTACGAGCCCACGG....... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................................GCTACGAGCCCATGAC...... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................AAGACTTGGGCTGAGTGGGCGA.................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................TTGACTGCTACGAGCCCA.......... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................TGTGCTGGTGACTGTTGGTGGC..................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................TTTTGACTGCTACGAGCCCAT......... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................GGTGACTGTTGGTGGCTATGG................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................TGGTGGACGAAGGAGACGAG.................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................GAATGTGCTGGTGACTGTTGGTGG...................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GTGACTGTTGGTGGCT.................................................................................................................................................................................... | 16 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| AGTTTCTTTGGGGAGCTGCTGGGTCAGGAGATAGACCCGCTCAGGAATGTGCTGGTGACTGTTGGTGGCTATGGGGCCCTGTTCACAGCCTTCCAGGCCCTGGTGGACGAAGGAGACGAGGTGAGTGGGCAAGACTTGGGCTGAGTGGGACTGAGAGGTCAGGGCCATGCTGACTCCAGCTGATTTGACCCTTATATCAGGTCATCATCATCGAACCCTTTTTTGACTGCTACGAGCCCATGACAATGAT ...............................................(((.((..((.(((..((.((((.(((((..(((....)))..)))))))))))..))).))..))..))).................................................................................................................................... ............................................45.............................................................................124............................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189787 | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR189782 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................CCCGCTCAGGAATGTGCTGACC................................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................AAGGCTGTGAACAGGGC.............................................................................................................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |