| (1) AGO2.ip | (2) BRAIN | (5) BREAST | (12) CELL-LINE | (1) CERVIX | (2) HEART | (1) HELA | (1) KIDNEY | (1) LIVER | (1) OTHER | (61) SKIN | (1) UTERUS | (1) XRN.ip |
| CCAGGCAAGAAATTAGATCTTAACTAAAAGCTCCCAAATCTTTAGGCATTTCAGGCATTTCTATGCCAGTTGGAGACTGGGGGAATTCCCCGAGGCCTCTCCAGAGTAAATAGACTGCATTCTTGTCTTGGTTCTCCTCTGGGGAGCCAGTGTCATTGACACCAAGCCCAGCATCCTCATGCACACTGTTCCTCTTGCAGGACTTGGAACACCATTTAGGGCTTGCCCTCAATGAGGTGCAGGCAGCCAA .............................................................................................((.((((((((((.....((((.........))))........)))))))))))).(((((...)))))........((((....))))...((((.......)))).................................................. ...................................................................................84..................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191412(GSM715522) 24genomic small RNA (size selected RNA from t. (breast) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR191567(GSM715677) 46genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189785 | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR191483(GSM715593) 11genomic small RNA (size selected RNA from t. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM541796(GSM541796) undifferentiated human embryonic stem cells. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................CCCGAGGCCTCTCCAGTCCG.............................................................................................................................................. | 20 | 154.00 | 0.00 | 42.00 | 8.00 | 4.00 | 2.00 | 6.00 | 2.00 | 3.00 | 3.00 | 1.00 | 5.00 | 3.00 | - | 1.00 | 3.00 | 1.00 | 4.00 | 4.00 | 1.00 | 1.00 | 3.00 | 1.00 | 2.00 | 1.00 | 2.00 | 2.00 | 1.00 | 2.00 | - | 2.00 | 2.00 | 3.00 | 2.00 | 1.00 | 1.00 | 3.00 | 2.00 | 2.00 | 2.00 | - | 2.00 | 1.00 | 1.00 | - | 2.00 | 2.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 2.00 | 1.00 | - | 2.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | |
| .........................................................................................CCGAGGCCTCTCCAGTCCG.............................................................................................................................................. | 19 | 0 | 122.00 | 2.00 | 2.00 | 4.00 | 5.00 | 6.00 | 2.00 | 6.00 | 4.00 | 4.00 | 6.00 | 2.00 | 4.00 | 4.00 | 5.00 | 2.00 | 4.00 | 1.00 | 1.00 | 3.00 | 4.00 | 2.00 | 2.00 | 2.00 | 3.00 | 2.00 | 1.00 | 3.00 | 1.00 | - | 2.00 | 2.00 | 1.00 | 1.00 | 3.00 | 3.00 | - | - | 1.00 | 1.00 | - | 1.00 | 2.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 2.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - |
| .........................................................................................CCGAGGCCTCTCCAGATC............................................................................................................................................... | 18 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGGACTTGGAACACCATTTAGGGCTTGC........................ | 28 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................CCGAGGCCTCTCCAGTCG............................................................................................................................................... | 18 | 0 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................CCGAGGCCTCTCCAG.................................................................................................................................................. | 15 | 0 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................CAGCATCCTCATGCACACTGTTCG.......................................................... | 24 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................ATGCACACTGTTCCTCTTGCAG.................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TCAGGCATTTCTATGCCAG..................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................TAGACTGCATTCTTGCTCA......................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................CCCGAGGCCTCTCCATGGC............................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................CCCGAGGCCTCTCCAGGTGG.............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................TTGGAGACTGGGGGAAGAT.................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................CCCGAGGCCTCTCCAGAGA............................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................CCTCATGCACACTGTTCCTCT....................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................TTTAGGGCTTGCCCTCAATGAGGTGCA......... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CCCGAGGCCTCTCCAGTCGC.............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................CCGAGGCCTCTCCAGTGG............................................................................................................................................... | 18 | 0 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................GCTTGCCCTCAATGAGGTGCAG........ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CCCGAGGCCTCTCCAGTGGC.............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................TGGAGACTGGGGGAAGAT.................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................ATTTCTATGCCAGTTGGAGACTG........................................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CCCGAGGCCTCTCCAGTGGA.............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .......................................................................................CCCCGAGGCCTCTCCAGT................................................................................................................................................. | 18 | 3 | 0.67 | 0.67 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CCCCGAGGCCTCTCCAG.................................................................................................................................................. | 17 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CCCGAGGCCTCTCCAGA................................................................................................................................................. | 17 | 5 | 0.60 | 0.60 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 | 0.20 |
| .......................................................................................CCCCGAGGCCTCTCCA................................................................................................................................................... | 16 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CCCCGAGGCCTCTCCAGTCC............................................................................................................................................... | 20 | 3 | 0.33 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CCCGAGGCCTCTCCAGACCGC............................................................................................................................................. | 21 | 5 | 0.20 | 0.60 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CCAGGCAAGAAATTAGATCTTAACTAAAAGCTCCCAAATCTTTAGGCATTTCAGGCATTTCTATGCCAGTTGGAGACTGGGGGAATTCCCCGAGGCCTCTCCAGAGTAAATAGACTGCATTCTTGTCTTGGTTCTCCTCTGGGGAGCCAGTGTCATTGACACCAAGCCCAGCATCCTCATGCACACTGTTCCTCTTGCAGGACTTGGAACACCATTTAGGGCTTGCCCTCAATGAGGTGCAGGCAGCCAA .............................................................................................((.((((((((((.....((((.........))))........)))))))))))).(((((...)))))........((((....))))...((((.......)))).................................................. ...................................................................................84..................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191412(GSM715522) 24genomic small RNA (size selected RNA from t. (breast) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR191567(GSM715677) 46genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189785 | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR191483(GSM715593) 11genomic small RNA (size selected RNA from t. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191548(GSM715658) 101genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | GSM541796(GSM541796) undifferentiated human embryonic stem cells. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................................................................GTAAATAGACTGCATCT................................................................................................................................ | 17 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....GCAAGAAATTAGATCTAATC.................................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................AAAGCTCCCAAATCTATTC............................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CCTCTCCAGAGTAAAGTT......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................TAGAAATGCCTGAAAT........................................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |