| (2) AGO2.ip | (2) B-CELL | (7) BREAST | (15) CELL-LINE | (1) CERVIX | (2) FIBROBLAST | (8) HEART | (1) HELA | (1) KIDNEY | (4) LIVER | (1) OTHER | (31) SKIN | (1) UTERUS | (2) XRN.ip |
| CGGCCACCTGAACTACAGCCAGAAACATAAACTGCCACTTTATTTATGTCTGAAAGCATCTAAGCCGCAAGCCTATCTGTCATGATCTAGCATGCACATGATAATAACAGGCTTGCCAGGCTAGGAAAGCTGCCCCATCGGATGGCCATGAGGACAGGCTCTAACAAGACTCTGTGCATTTTCTCCCCCATTATCCACAGCCCACACATCATGTTCCTCTCTCAGAGCATCTTGACAGGAGGGAACCATC ...............................................((((...(((.(((.((((((((((((((((((((((......)))).))).)))......))))))))..)))).)))...(((((.(((.((....))))).)).))))))......))))................................................................................ ............................................45.................................................................................................................................176........................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR343335 | SRR343334 | SRR343336 | SRR343337 | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189785 | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189783 | SRR189782 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | TAX577738(Rovira) total RNA. (breast) | TAX577745(Rovira) total RNA. (breast) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR029124(GSM416753) HeLa. (hela) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR040009(GSM532894) G727T. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR191558(GSM715668) 61genomic small RNA (size selected RNA from t. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR207119(GSM721081) XRN1&2 knockdown. (XRN1/XRN2 cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................TGAAAGCATCTAAGC......................................................................................................................................................................................... | 15 | 4 | 70.75 | 70.75 | 27.00 | 30.25 | 7.50 | 5.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCG........................................................................................................................................................................................ | 17 | 4 | 65.50 | 61.25 | 16.25 | 16.75 | 13.75 | 14.00 | - | 1.25 | - | 0.25 | - | - | - | - | - | - | - | 0.25 | - | 0.50 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGC......................................................................................................................................................................................... | 16 | 4 | 61.25 | 61.25 | 16.25 | 12.50 | 16.25 | 14.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCG........................................................................................................................................................................................ | 16 | 4 | 53.75 | 70.75 | 16.00 | 12.00 | 11.75 | 13.00 | - | - | - | 0.50 | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGGG...................................................................................................................................................................................... | 19 | 4 | 30.00 | 61.25 | 4.50 | 2.75 | 4.50 | 4.50 | 9.75 | 0.75 | - | 0.25 | - | 0.25 | 0.25 | 0.25 | - | 0.25 | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | - | - | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGG....................................................................................................................................................................................... | 18 | 4 | 26.25 | 61.25 | 6.50 | 6.25 | 5.25 | 4.25 | - | - | - | - | - | - | 0.25 | - | - | 0.25 | 0.25 | 0.25 | - | - | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.25 | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | - |
| .................................................CTGAAAGCATCTAAGCGGGA..................................................................................................................................................................................... | 20 | 4 | 21.25 | 61.25 | 2.50 | 0.75 | 2.50 | 3.25 | 6.50 | 0.75 | - | - | - | 2.00 | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | 0.25 | - | - | 0.25 | - | - | 0.25 | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | 0.25 |
| ..................................................TGAAAGCATCTAAGCGG....................................................................................................................................................................................... | 17 | 4 | 19.25 | 70.75 | 4.00 | 4.25 | 4.00 | 5.00 | - | 1.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCGGGA..................................................................................................................................................................................... | 19 | 4 | 11.25 | 70.75 | 2.25 | 1.25 | 2.50 | 2.75 | 1.00 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCGGG...................................................................................................................................................................................... | 18 | 4 | 11.25 | 70.75 | 2.00 | 1.25 | 1.50 | 2.50 | 1.50 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| .................................................CTGAAAGCATCTAAGTAGG...................................................................................................................................................................................... | 19 | 6.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................TCTGAAAGCATCTAAGCGG....................................................................................................................................................................................... | 19 | 5.00 | 0.00 | 1.00 | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................CTGAAAGCATCTAAGCATC...................................................................................................................................................................................... | 19 | 4 | 5.00 | 61.25 | - | - | - | - | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGTGG....................................................................................................................................................................................... | 18 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................CTGAAAGCATCTAAGTAG....................................................................................................................................................................................... | 18 | 4.00 | 0.00 | - | - | - | - | - | - | - | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................CTGAAAGCATCTAAGCGA....................................................................................................................................................................................... | 18 | 4 | 3.75 | 61.25 | 0.75 | 0.50 | 1.75 | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGTGGG...................................................................................................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................CTGAAAGCATCTAAGCGC....................................................................................................................................................................................... | 18 | 4 | 2.00 | 61.25 | - | - | - | - | - | 1.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGATC..................................................................................................................................................................................... | 20 | 4 | 1.25 | 61.25 | - | - | - | - | - | - | 1.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................CTCAGAGCATCTTGACAGGAGGGAA..... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCGGA...................................................................................................................................................................................... | 18 | 4 | 1.00 | 70.75 | 0.25 | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................CTTGACAGGAGGGAACCAT. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................CAGGCTCTAACAAGACAG.............................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................CCTCTCTCAGAGCATCTT................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TTTTCTCCCCCATTATTCTT.................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................ACAGGCTTGCCAGGCTGGGC............................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................TGAGGACAGGCTCTAACAAGACT............................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................CAGAGCATCTTGACAGGAGGGAACC... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................GCCATGAGGACAGGCTCTAACA.................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................TCCACAGCCCACACATCATGT.................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................GTCTGAAAGCATCTAAGG......................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................TCTGAAAGCATCTAAGCGGGA..................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................TCTGAAAGCATCTAAGCG........................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................CATCTTGACAGGAGGGAACCATC | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGTGA..................................................................................................................................................................................... | 20 | 4 | 1.00 | 61.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGGA...................................................................................................................................................................................... | 19 | 4 | 0.75 | 61.25 | - | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGT....................................................................................................................................................................................... | 18 | 4 | 0.75 | 61.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - |
| ..................................................TGAAAGCATCTAAGCGA....................................................................................................................................................................................... | 17 | 4 | 0.75 | 70.75 | - | - | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCGTGA..................................................................................................................................................................................... | 19 | 4 | 0.50 | 70.75 | - | - | - | - | - | - | - | 0.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCACG...................................................................................................................................................................................... | 19 | 4 | 0.50 | 61.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCACGA..................................................................................................................................................................................... | 20 | 4 | 0.50 | 61.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCGC....................................................................................................................................................................................... | 17 | 4 | 0.50 | 70.75 | 0.25 | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCACG...................................................................................................................................................................................... | 18 | 4 | 0.25 | 70.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGTG...................................................................................................................................................................................... | 19 | 4 | 0.25 | 61.25 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGTAA..................................................................................................................................................................................... | 20 | 4 | 0.25 | 61.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCACGA..................................................................................................................................................................................... | 19 | 4 | 0.25 | 70.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - |
| ..................................................TGAAAGCATCTAAGCAC....................................................................................................................................................................................... | 17 | 4 | 0.25 | 70.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................CTGAAAGCATCTAAGCGCCA..................................................................................................................................................................................... | 20 | 4 | 0.25 | 61.25 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CGGCCACCTGAACTACAGCCAGAAACATAAACTGCCACTTTATTTATGTCTGAAAGCATCTAAGCCGCAAGCCTATCTGTCATGATCTAGCATGCACATGATAATAACAGGCTTGCCAGGCTAGGAAAGCTGCCCCATCGGATGGCCATGAGGACAGGCTCTAACAAGACTCTGTGCATTTTCTCCCCCATTATCCACAGCCCACACATCATGTTCCTCTCTCAGAGCATCTTGACAGGAGGGAACCATC ...............................................((((...(((.(((.((((((((((((((((((((((......)))).))).)))......))))))))..)))).)))...(((((.(((.((....))))).)).))))))......))))................................................................................ ............................................45.................................................................................................................................176........................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR343335 | SRR343334 | SRR343336 | SRR343337 | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189785 | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189783 | SRR189782 | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | TAX577738(Rovira) total RNA. (breast) | TAX577745(Rovira) total RNA. (breast) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR029124(GSM416753) HeLa. (hela) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR040009(GSM532894) G727T. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR191558(GSM715668) 61genomic small RNA (size selected RNA from t. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR207119(GSM721081) XRN1&2 knockdown. (XRN1/XRN2 cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................................................................GTCCTCATGGCCATC............................................................................................... | 15 | 2 | 3.00 | 3.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......TTTATGTTTCTGGCTGTAGTTCAG........................................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................ACATAAACTGCCACTTAGTG.............................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................AGGCTTGCGGCTTAGATG................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................GTCAAGATGCTCTGAGAG.............. | 18 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |