| (1)  AGO2.ip  | (2)  BRAIN  | (16)  BREAST  | (14)  CELL-LINE  | (3)  CERVIX  | (2)  HEART  | (1)  HELA  | (1)  OTHER  | (23)  SKIN  | 
| GTAAAACATTCTGACATCCTGTTTTCATTTGTAATGGTATCATCAAATGAAAGTAGAAAAGTAGAAAAGCTGAATAAGAAATCACATGGGTCTTCTTAGCTCACATCATCCGGGATTTACCTAGAACCTCCCACTGGACTTGTCTATATGACGGGCGACCACTCAGTAATCACCAACCTTTTGTTTCTGCCCCTCACCAGGTACATGGTGCAGTGGCCGGGAGCACGCATCCTTCGGCGTCAGGAGCTAG ....................................................(((((.((((.....((((((..((((..((....)).)))).))))))..........((((.............)))).....)))).))))).....((....)).......................................................................................... ..................................................51......................................................................................................................................187.............................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line)  | TAX577590(Rovira) total RNA. (breast)  | TAX577742(Rovira) total RNA. (breast)  | TAX577580(Rovira) total RNA. (breast)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | TAX577453(Rovira) total RNA. (breast)  | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line)  | TAX577589(Rovira) total RNA. (breast)  | TAX577740(Rovira) total RNA. (breast)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577588(Rovira) total RNA. (breast)  | TAX577746(Rovira) total RNA. (breast)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | GSM532877(GSM532877) G691N. (cervix)  | SRR040037(GSM532922) G243T. (cervix)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin)  | SRR189785 | TAX577739(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | TAX577744(Rovira) total RNA. (breast)  | TAX577738(Rovira) total RNA. (breast)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | GSM532886(GSM532886) G850T. (cervix)  | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast)  | TAX577745(Rovira) total RNA. (breast)  | SRR553574(SRX182780) source: Heart. (Heart)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela)  | TAX577743(Rovira) total RNA. (breast)  | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | TAX577579(Rovira) total RNA. (breast)  | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin)  | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin)  | SRR343333(GSM796036) KSHV (HHV8). (cell line)  | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin)  | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................TAGAAAAGTAGAAAAGGGG.................................................................................................................................................................................. | 19 | 58.00 | 0.00 | 58.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................TAGAAAAGTAGAAAAGGGGA................................................................................................................................................................................. | 20 | 46.00 | 0.00 | 38.00 | - | - | - | - | - | 7.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................GCATCCTTCGGCGTCAGG...... | 18 | 1 | 8.00 | 8.00 | - | - | - | - | 8.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............................................................................................................................................................................................................................AGCACGCATCCTTCGGCGTCAGGAGC... | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........................................................AGTAGAAAAGCTGAATAAG............................................................................................................................................................................ | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........................................................................................................................................................................................................................GGGAGCACGCATCCTTCGGCGTCAGG...... | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............................................................................................................................................................................................................TGGTGCAGTGGCCGGGAGCACGCACCCC................. | 28 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................CAAATGAAAGTAGAAAGCAT........................................................................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................TAGAAAAGTAGAAAAGGGGT................................................................................................................................................................................. | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................CGGGAGCACGCATCCTTCGGCGTCAGGA..... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .........................................................................................................................................................................................................TACATGGTGCAGTGGCCGGGAGCACGCACCCT................. | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................ATCACCAACCTTTTGGCG................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................TGTAATGGTATCATCAAATGAAAGTAGAAAA.............................................................................................................................................................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................GAAAAGTAGAAAAGCTGAATAAGAAATC....................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........................................................................................................................................................................................................CATGGTGCAGTGGCCGG.............................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................AAGTAGAAAAGTAGAAAAGCTG.................................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................................................................................................CACGCATCCTTCGGCGTCAGGAGCTAGACG | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................TCCCACTGGACTTGTGGA........................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................TTCGGCGTCAGGAGCTAG | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................................................................................................................TTCGGCGTCAGGAGC... | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................ATGAAAGTAGAAAAGCAGA......................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................TAATGGTATCATCAAATGAAAGTAGAAAAGTAGAAAAGCTGAATAAGAAATCACATGGGTCTTCTTAGCTCACATCATCCGGGATTTACC................................................................................................................................. | 90 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........................................CAAATGAAAGTAGAAAAGTAGA......................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................AGTAGAAAAGTAGAAAAGCTGAATAAG............................................................................................................................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................................................................................TTGTTTCTGCCCCTCAC..................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................AAGTAGAAAAGTAGAAAA...................................................................................................................................................................................... | 18 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | 
| ..................................................AAGTAGAAAAGTAGAAAAACT................................................................................................................................................................................... | 21 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| GTAAAACATTCTGACATCCTGTTTTCATTTGTAATGGTATCATCAAATGAAAGTAGAAAAGTAGAAAAGCTGAATAAGAAATCACATGGGTCTTCTTAGCTCACATCATCCGGGATTTACCTAGAACCTCCCACTGGACTTGTCTATATGACGGGCGACCACTCAGTAATCACCAACCTTTTGTTTCTGCCCCTCACCAGGTACATGGTGCAGTGGCCGGGAGCACGCATCCTTCGGCGTCAGGAGCTAG ....................................................(((((.((((.....((((((..((((..((....)).)))).))))))..........((((.............)))).....)))).))))).....((....)).......................................................................................... ..................................................51......................................................................................................................................187.............................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line)  | TAX577590(Rovira) total RNA. (breast)  | TAX577742(Rovira) total RNA. (breast)  | TAX577580(Rovira) total RNA. (breast)  | SRR207110(GSM721072) Nuclear RNA. (cell line)  | TAX577453(Rovira) total RNA. (breast)  | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line)  | TAX577589(Rovira) total RNA. (breast)  | TAX577740(Rovira) total RNA. (breast)  | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577588(Rovira) total RNA. (breast)  | TAX577746(Rovira) total RNA. (breast)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | GSM532877(GSM532877) G691N. (cervix)  | SRR040037(GSM532922) G243T. (cervix)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin)  | SRR189785 | TAX577739(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR060168(GSM565978) 5-8F_nucleus. (cell line)  | TAX577744(Rovira) total RNA. (breast)  | TAX577738(Rovira) total RNA. (breast)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | GSM532886(GSM532886) G850T. (cervix)  | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast)  | TAX577745(Rovira) total RNA. (breast)  | SRR553574(SRX182780) source: Heart. (Heart)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela)  | TAX577743(Rovira) total RNA. (breast)  | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)  | TAX577579(Rovira) total RNA. (breast)  | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin)  | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin)  | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin)  | SRR343333(GSM796036) KSHV (HHV8). (cell line)  | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin)  | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................................................................TCCCGGCCACTGCACCA............................ | 17 | 1 | 55.00 | 55.00 | - | 10.00 | 10.00 | 7.00 | - | 6.00 | - | 3.00 | 3.00 | - | - | 1.00 | 2.00 | - | 2.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............................................................................................................................................................................................................CCCGGCCACTGCACCA............................. | 16 | 3 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | - | - | - | - | 
| ..............................................................................................................................................................................................................GGTGCAGTGGCCGGGAC........................... | 17 | 3.50 | 0.00 | - | 2.00 | - | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................CCGGCCACTGCACCA.............................. | 15 | 5 | 1.60 | 1.60 | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | 0.20 | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.40 | - | - | - | - | - | - | - | - | 0.20 | 0.20 | 0.20 | - | - | 
| ...............................................................................................................................................................................................................GTGCAGTGGCCGGGAGAA......................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................TCAAATGAAAGTAGAAAATCA........................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................GGTGCAGTGGCCGGGAGC.......................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................GTGCAGTGGCCGGGAGA.......................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................TTTTGTTTCTGCCCCTTAG..................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................AAATGAAAGTAGAAAAGTG........................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................AGTAGAAAAGTAGAAACTT.................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................TGGTGCAGTGGCCGGGAAT.......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................TGGTGCAGTGGCCGGGACG.......................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................TCCCGGCCACTGCACC............................ | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................................................GGTGCAGTGGCCGGGATTGA........................ | 20 | 0.50 | 0.00 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................TTTTCTACTTTCATTTG.............................................................................................................................................................................................. | 17 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - |