| (1) AGO1.ip OTHER.mut | (5) B-CELL | (1) BRAIN | (9) BREAST | (25) CELL-LINE | (1) CERVIX | (4) HEART | (1) HELA | (3) LIVER | (2) OTHER | (1) RRP40.ip | (25) SKIN | (1) UTERUS | (1) XRN.ip |
| TATTGCTGGCAGCCTCAATTTAATATGCCATTCAGCTAGGTTCTGTAGGGTGAAGTAATGGTCTAATAATTACTGGCACCTCTGCTGGAATCATCACGAGACAGGAATAAAGGACCCTGACCTTAGAATCCTCGCCTGCTTATTATCGTACATTAGTTGCTATAGATGATAATATAACCTGGTTTTCATTGCTCTTGTAGGAACTGGGAGCAGTGTCTCTGGATGGCTACTTTCATCTCTGGAAGGCTGA ......................................................................................................................................((....(((((((((....(((...)))...)))))))))......)).................................................................... ......................................................................................................................119............................................................182.................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR191410(GSM715520) 20genomic small RNA (size selected RNA from t. (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191568(GSM715678) 51genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR189787 | SRR040011(GSM532896) G529T. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR037938(GSM510476) 293Red. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR038856(GSM458539) D11. (cell line) | SRR191455(GSM715565) 181genomic small RNA (size selected RNA from . (breast) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR037935(GSM510473) 293cand3. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR191414(GSM715524) 31genomic small RNA (size selected RNA from t. (breast) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................TAGAATCCTCGCCTGCCACG........................................................................................................... | 20 | 1 | 33.00 | 7.00 | - | - | 2.00 | 3.00 | - | 2.00 | 2.00 | 1.00 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | 2.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TAGAATCCTCGCCTGCCAC............................................................................................................ | 19 | 1 | 16.00 | 7.00 | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TAGAATCCTCGCCTGC............................................................................................................... | 16 | 1 | 7.00 | 7.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TAGAATCCTCGCCTGCC.............................................................................................................. | 17 | 1 | 4.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................AGAATCCTCGCCTGCCAC............................................................................................................ | 18 | 2 | 3.00 | 1.50 | - | - | - | - | - | - | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | 0.50 | - | - | 0.50 |
| .............................................................................................................................................................................................................GGGAGCAGTGTCTCTGGATGGCT...................... | 23 | 1 | 3.00 | 3.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TAGAATCCTCGCCTGCCA............................................................................................................. | 18 | 1 | 2.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................GCAGTGTCTCTGGATGGCTACTT.................. | 23 | 1 | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................GGGAGCAGTGTCTCTGGATGGC....................... | 22 | 1 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................TAGAATCCTCGCCTG................................................................................................................ | 15 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................GAGCAGTGTCTCTGGATGGCTTTA................... | 24 | 1 | 2.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................AGAATCCTCGCCTGCCACG........................................................................................................... | 19 | 2 | 2.00 | 1.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | 0.50 | 0.50 | - |
| ............................................................................................................................AGAATCCTCGCCTGC............................................................................................................... | 15 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................ACTGGGAGCAGTGTCTCTGGATGGCTAATCT................. | 31 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................AGTTGCTATAGATGATAATATAAC........................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................ACTGGGAGCAGTGTCTCTGGATGGCC...................... | 26 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................GCAGTGTCTCTGGATGGCTACT................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGAACTGGGAGCAGTGTCTC............................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................TGGCTACTTTCATCTCTGG........ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CTGCTGGAATCATCACC........................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGGAACTGGGAGCAGTGTCTCTGGATGGCC...................... | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................TAGAATCCTCGCCTGCCAAG........................................................................................................... | 20 | 1 | 1.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................CTCTTGTAGGAACTGG........................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................GGGAGCAGTGTCTCTGGATGGCTACT................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAACTGGGAGCAGTGTCTCTGGATGGCTA..................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGAACTGGGAGCAGTGTCTCCGG............................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAACTGGGAGCAGTGTCTCTGGATGGCT...................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................TGTCTCTGGATGGCTTTTT.................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................AGCAGTGTCTCTGGATGGCTACT................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................TTAGAATCCTCGCCTGCTTATT.......................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAACTGGGAGCAGTGTCTCTGGATGGCT...................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................CTGGGAGCAGTGTCTCTGGATGGC....................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................AGTGTCTCTGGATGGC....................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TTCATCTCTGGAAGGCTG. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................GTAGGAACTGGGAGCAGTGTCTCTGGA........................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................GTGTCTCTGGATGGCTACTTTC................ | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................CTGGGAGCAGTGTCTCTGGATGGCTACTTTC................ | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................GAGCAGTGTCTCTGGATGGCT...................... | 21 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAACTGGGAGCAGTGTCTCTGGATGGCC...................... | 28 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................GTGTCTCTGGATGGCTACTTTCATCTC........... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................AGTGTCTCTGGATGGCTA..................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGAACTGGGAGCAGTGT.................................. | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGAACTGGGAGCAGT.................................... | 16 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TATTGCTGGCAGCCTCAATTTAATATGCCATTCAGCTAGGTTCTGTAGGGTGAAGTAATGGTCTAATAATTACTGGCACCTCTGCTGGAATCATCACGAGACAGGAATAAAGGACCCTGACCTTAGAATCCTCGCCTGCTTATTATCGTACATTAGTTGCTATAGATGATAATATAACCTGGTTTTCATTGCTCTTGTAGGAACTGGGAGCAGTGTCTCTGGATGGCTACTTTCATCTCTGGAAGGCTGA ......................................................................................................................................((....(((((((((....(((...)))...)))))))))......)).................................................................... ......................................................................................................................119............................................................182.................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR191410(GSM715520) 20genomic small RNA (size selected RNA from t. (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191568(GSM715678) 51genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR189787 | SRR040011(GSM532896) G529T. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR037938(GSM510476) 293Red. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR038856(GSM458539) D11. (cell line) | SRR191455(GSM715565) 181genomic small RNA (size selected RNA from . (breast) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR037935(GSM510473) 293cand3. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR191414(GSM715524) 31genomic small RNA (size selected RNA from t. (breast) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................GCCATTCAGCTAGGTTCTGAA........................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................CCTCTGCTGGAATCAGAAC......................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................AGAACCTAGCTGAATGG.............................................................................................................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |