| (9) B-CELL | (1) BRAIN | (10) BREAST | (17) CELL-LINE | (2) FIBROBLAST | (3) HEART | (1) HELA | (3) LIVER | (2) OTHER | (19) SKIN | (2) UTERUS | (1) XRN.ip |
| AGGGGTGAGCTGCAGGGGGCCAGGAAAGGGTGACTGTGACTCTGGGAGCAGCCGTGCCAAGGCCCTGGGACAGGAGGGGCTTGGCCAGCCTCAAGGCCTTACTCCAGCCCACTGCACTCTCAGATTCCAGCTCCCTGGGGCAGGTGAGATGGCCGAGCCAGGTCCTTGGATGATCTCTGTTCCTGTTCCCCTCTTCCCAGGAAGCGCCGCGGAGCCATCAACAGCAAGCAGCTCACCTACCTGGAGAAAT .........................................................................................................................................(((((((.(((((..(((((.......)))))...)))))....))))))).............................................................. .........................................................................................................................................138...........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR343337 | SRR343336 | SRR189784 | SRR189785 | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189783 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR189782 | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR343334 | SRR343335 | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | TAX577746(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577741(Rovira) total RNA. (breast) | SRR037938(GSM510476) 293Red. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | TAX577453(Rovira) total RNA. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | TAX577745(Rovira) total RNA. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR189787 | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577579(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................................GGTGAGATGGCCGAGCGG.......................................................................................... | 18 | 2 | 58.50 | 0.50 | 9.00 | 7.00 | 5.00 | 7.00 | 7.00 | 5.00 | 1.00 | - | 2.00 | - | 0.50 | 1.00 | - | 2.00 | - | - | - | 2.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGTTG.......................................................................................... | 18 | 3 | 17.33 | 6.00 | - | - | 0.33 | - | - | - | 6.67 | 2.00 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | 1.67 | 1.67 | - | - | - | - | - | 1.33 | 1.00 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | 0.67 | - | - | - | - | - | - | 0.33 | 0.33 | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCG........................................................................................... | 17 | 2 | 16.50 | 0.50 | 10.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGGTC........................................................................................ | 20 | 2 | 11.00 | 0.50 | 4.00 | - | 3.00 | - | - | 3.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCTCGG.............................. | 20 | 2 | 8.00 | 0.50 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAG............................................................................................. | 15 | 3 | 6.00 | 6.00 | 0.33 | 1.67 | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | 0.33 | - | - | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | 0.67 | - | - | - | - | - | - | 0.33 | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGTTGG......................................................................................... | 19 | 3 | 6.00 | 6.00 | 0.33 | 1.33 | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.67 | - | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGGT......................................................................................... | 19 | 2 | 5.00 | 0.50 | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCTG.......................................................................................... | 18 | 2 | 5.00 | 0.50 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................AAGCGCCGCGGAGCCTCG............................... | 18 | 2 | 3.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCTC................................ | 18 | 2 | 2.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................AAGCGCCGCGGAGCCTC................................ | 17 | 2 | 2.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................AAGCGCCGCGGAGCCTCGG.............................. | 19 | 2 | 2.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGGGC........................................................................................ | 20 | 2 | 2.00 | 0.50 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................AAGCGCCGCGGAGCC.................................. | 15 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................CCCTGGGGCAGGTGAGATGGCCGAGCC........................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCCG.......................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGA.......................................................................................... | 18 | 2 | 1.00 | 0.50 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................ATCAACAGCAAGCAGCGG................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................AGGAAAGGGTGACTGTGACTC................................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGT.......................................................................................... | 18 | 2 | 1.00 | 0.50 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCGCGG.............................. | 20 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGCGGG......................................................................................... | 19 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................CCCTGGGGCAGGTGAGATGGC................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................ACAGCAAGCAGCTCATAGA........... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................GTGAGATGGCCGAGCGGTC........................................................................................ | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................GGTGAGATGGCCGAGA............................................................................................ | 16 | 3 | 1.00 | 6.00 | 0.33 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCTG................................ | 18 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................ACAGCAAGCAGCTCACCTACCTGA...... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................TCCTGTTCCCCTCTTGCAT................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCTGGG.............................. | 20 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................GTCCTTGGATGATCTGGG....................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCCT................................. | 17 | 2 | 1.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGTGG.......................................................................................... | 18 | 3 | 0.67 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | 0.33 | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGCC.................................. | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGC............................................................................................ | 16 | 2 | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGCGCCGCGGAGC................................... | 15 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................AGCGCCGCGGAGCCA................................. | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - |
| ..........................................................................................................................................................................................................AGCGCCGCGGAGCCACGGT............................. | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |
| ..............................................................................................................................................GGTGAGATGGCCGAGGGG.......................................................................................... | 18 | 3 | 0.33 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................ATCAACAGCAAGCAG................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| AGGGGTGAGCTGCAGGGGGCCAGGAAAGGGTGACTGTGACTCTGGGAGCAGCCGTGCCAAGGCCCTGGGACAGGAGGGGCTTGGCCAGCCTCAAGGCCTTACTCCAGCCCACTGCACTCTCAGATTCCAGCTCCCTGGGGCAGGTGAGATGGCCGAGCCAGGTCCTTGGATGATCTCTGTTCCTGTTCCCCTCTTCCCAGGAAGCGCCGCGGAGCCATCAACAGCAAGCAGCTCACCTACCTGGAGAAAT .........................................................................................................................................(((((((.(((((..(((((.......)))))...)))))....))))))).............................................................. .........................................................................................................................................138...........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR343337 | SRR343336 | SRR189784 | SRR189785 | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189783 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR189782 | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR444041(SRX128889) Sample 2cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR343334 | SRR343335 | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR444044(SRX128892) Sample 5cDNABarcode: AF-PP-340: ACG CTC TTC C. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | TAX577746(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191407(GSM715517) 81genomic small RNA (size selected RNA from t. (breast) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577741(Rovira) total RNA. (breast) | SRR037938(GSM510476) 293Red. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | TAX577453(Rovira) total RNA. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | TAX577745(Rovira) total RNA. (breast) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR189787 | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577579(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................TTCCTGTTCCCCTCTTCA..................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................CTCCCTGGGGCAGGTTCTG..................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................AGCAAGCAGCTCACCTTG.......... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................TGGGGCAGGTGAGATGACCC............................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................CGGAGCCATCAACAGGCGG...................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................CTGTTCCTGTTCCCCGGTC....................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |