| (1) AGO2.ip | (8) B-CELL | (3) BRAIN | (5) BREAST | (29) CELL-LINE | (1) CERVIX | (1) HEART | (3) HELA | (4) LIVER | (5) OTHER | (9) SKIN | (2) UTERUS | (1) XRN.ip |
| TTGAAGTCGGGGGATGGTATTACTTTTGGAGTGTTTGGAAGTAAATTCAGGTAAGACATTTTAAAATTGATTTTAAAATGGACAGCTTTGTTTCAGCCAAATCCTAAAGGAAAATGATATTTCTGATTAATGAATTTAAAACAGTATAATTTAGTTCCTGCTTAGCACAGTATTGGACTCTGTGCCATGGGTGGTGAGTGCATTTTGTACATCACGGTGATGAGAGTTTGAGTGGGCCCTGAGGGACTTCATGGGAAGTTACATTTCTTCGATTCCTCATTGGTGAAGGTATAATGTTAACTTTTGGTCATTGTTTTTTCTTCATTTGGACTCAAGACTTAGGATTTGATAATTTTCTAGGTTACAAAGCTTAATGATGAGGAACTGATAATTTCATAGGTTACAAAGGGTAACAATAAATAAAAGTTACAATAACAGTATATGATGTGAGCTTAAAGTTTTAAAGTACTAAAAATTGCCATCTCTGCAACTCTGATACTATGACTTTATTTAACTTATTCTCATTTACAGAATAGAGTATGAGCCTTTGGTTGCATGCTCTTCTTGTTTAGATGTCTCTG .....................................................................................................................................................................................................................................................................................................................((((((..(((((((((.((......(((((((((..........)))))))))......))....)))))))))..))))))............................................................................................................................................................................................. ..............................................................................................................................................................................................................................................................................................................303........................................................................................394......................................................................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR037943(GSM510481) 293DcrTN. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR037931(GSM510469) 293GFP. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR191610(GSM715720) 195genomic small RNA (size selected RNA from . (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR343334 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR189787 | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | SRR189785 | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029127(GSM416756) A549. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR038859(GSM458542) MM386. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR038862(GSM458545) MM472. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040024(GSM532909) G613N. (cervix) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................................................................................................................................................................................................................................................CTTAATGATGAGGAACTGATA............................................................................................................................................................................................... | 21 | 1 | 67.00 | 67.00 | 7.00 | 5.00 | 5.00 | 3.00 | 1.00 | 4.00 | - | 4.00 | - | - | 2.00 | - | 3.00 | 3.00 | 3.00 | 2.00 | - | - | 2.00 | 2.00 | 1.00 | 2.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................................................................................GCTTAATGATGAGGAACTGATA............................................................................................................................................................................................... | 22 | 1 | 9.00 | 9.00 | - | - | - | - | 3.00 | - | - | - | - | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAATAGAGTATGAGCC................................... | 18 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....AGTCGGGGGATGGTATTACTTCTGG........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ | 25 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........GGGATGGTATTACTTTTGGAGTGTTT................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTGGTTGCATGCTCTTCT................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............GATGGTATTACTTTTGGAGTGTTTGGA.............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACAGAATAGAGTATGTTCT................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAATAGAGTATGAGCCTT................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........GGGGGATGGTATTACTTTTGGA....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................................................................................................................TCATTGTTTTTTCTTTGGG............................................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCCTTTGGTTGCATGCT..................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TCACGGTGATGAGAGTTTGAGT............................................................................................................................................................................................................................................................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATAGAGTATGAGCCTTTGG.............................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....AGTCGGGGGATGGTATTACT............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ........................TTTGGAGTGTTTGGAAGTAAATTCAG................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................................................................................................................................................................GCTTAATGATGAGGAACTGATT............................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................TTGGAGTGTTTGGAAGC........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTTTATTTAACTTATTCTCATTTACAG.................................................. | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .TGAAGTCGGGGGATGGTATA................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTGGTTGCATGCTCTTC................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................CTTTTGGAGTGTTTGGAAG............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................TGTTTGGAAGTAAATTAATA.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................GAGTGTTTGGAAGTAAATT...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................TTTTGGAGTGTTTGGAAGTAAATT...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................................................................................................................................................................AATGATGAGGAACTGAAC............................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATGCTCTTCTTGTTTAGATGT..... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGAGTATGAGCCTTTGTGTC........................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................................CACGGTGATGAGAGTTTGAGTGGGCCCTGAGG................................................................................................................................................................................................................................................................................................................................................. | 32 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...AAGTCGGGGGATGGTATTACT............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................................................................................................................AGGAACTGATAATTTCATAGGTTACAAAGGGT.......................................................................................................................................................................... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................ATGAGAGTTTGAGTGGGCCCTGAGGG................................................................................................................................................................................................................................................................................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .TGAAGTCGGGGGATGGACAG................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................................................................................................................................................................................ATAATTTCATAGGTTACAAAGGGC.......................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................................................................................................................................................CTTAATGATGAGGAACT................................................................................................................................................................................................... | 17 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - |
| ........................TTTGGAGTGTTTGGAAGTA.......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................AGGAAAATGATATTTCTG........................................................................................................................................................................................................................................................................................................................................................................................................................................................................ | 18 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................................................................................................................................................................CTTAATGATGAGGAACTCATC............................................................................................................................................................................................... | 21 | 3 | 0.33 | 0.67 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................................................................................................................................................................ATGATGAGGAACTGATA............................................................................................................................................................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................TTTTGGAGTGTTTGGAAGT........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................TTTTGGAGTGTTTGGAAGTCT......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 21 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| ..................................TTGGAAGTAAATTCAG................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |
| TTGAAGTCGGGGGATGGTATTACTTTTGGAGTGTTTGGAAGTAAATTCAGGTAAGACATTTTAAAATTGATTTTAAAATGGACAGCTTTGTTTCAGCCAAATCCTAAAGGAAAATGATATTTCTGATTAATGAATTTAAAACAGTATAATTTAGTTCCTGCTTAGCACAGTATTGGACTCTGTGCCATGGGTGGTGAGTGCATTTTGTACATCACGGTGATGAGAGTTTGAGTGGGCCCTGAGGGACTTCATGGGAAGTTACATTTCTTCGATTCCTCATTGGTGAAGGTATAATGTTAACTTTTGGTCATTGTTTTTTCTTCATTTGGACTCAAGACTTAGGATTTGATAATTTTCTAGGTTACAAAGCTTAATGATGAGGAACTGATAATTTCATAGGTTACAAAGGGTAACAATAAATAAAAGTTACAATAACAGTATATGATGTGAGCTTAAAGTTTTAAAGTACTAAAAATTGCCATCTCTGCAACTCTGATACTATGACTTTATTTAACTTATTCTCATTTACAGAATAGAGTATGAGCCTTTGGTTGCATGCTCTTCTTGTTTAGATGTCTCTG .....................................................................................................................................................................................................................................................................................................................((((((..(((((((((.((......(((((((((..........)))))))))......))....)))))))))..))))))............................................................................................................................................................................................. ..............................................................................................................................................................................................................................................................................................................303........................................................................................394......................................................................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR037943(GSM510481) 293DcrTN. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR037931(GSM510469) 293GFP. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR191610(GSM715720) 195genomic small RNA (size selected RNA from . (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR343334 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR189787 | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | SRR189785 | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR038858(GSM458541) MEL202. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029127(GSM416756) A549. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR038859(GSM458542) MM386. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR038862(GSM458545) MM472. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040024(GSM532909) G613N. (cervix) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................ATTTTAAAATTGATTCG........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................TTAGCACAGTATTGGACTGA................................................................................................................................................................................................................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................................TTCTTCGATTCCTCATC............................................................................................................................................................................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................................................................................................................................................................................................TACCCTTTGTAACCTATG......................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................................................................................................................................................TGATAATTTTCTAGGTTT......................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................AGGAACTAAATTATACTG...................................................................................................................................................................................................................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................GGACTCTGTGCCATGTG...................................................................................................................................................................................................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |