| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (1) AGO2.ip | (17) B-CELL | (2) BRAIN | (5) BREAST | (9) CELL-LINE | (4) CERVIX | (1) FIBROBLAST | (3) LIVER | (1) OTHER | (25) SKIN | (1) UTERUS |
| CAGCAGCCTGGGCAGCACAACATTCTGGGAGGGCTTCTCCTGGCCTGAGCGTAAGTGTCCCCAACACAGGGGAGAGGGAGCTGGGAGCCCAAGCCCTAGGGATCGGGTGGCAGAGGAGTCCCAGGGTGACCCCGAGGGGCTGGAAGCAGGTGTTGCTGCCGCCGGGGCAGGGGCTTCAGGGCTGAGGAGGCCAATGGCCGTTCTGTCTCCTCCTGTAGTTCGCCCAAAGTCAGACGAGGGCTCTGTCCTCCTGCTGCACCGAGCTTTG ..........................................................................................(((((((.....((.((((((((...((((((.(((....)))..))))))...(((....))).)))))))).))...)))))))(((((..((((.((((...))))......)))).)))))..................................................... ..........................................................................................91.............................................................................................................................218................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR189784 | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR343334 | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR040032(GSM532917) G603N. (cervix) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR040042(GSM532927) G428N. (cervix) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR040036(GSM532921) G243N. (cervix) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR343335 | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR040027(GSM532912) G220T. (cervix) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR037937(GSM510475) 293cand2. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................CTAGGGATCGGGTGGTGTT.......................................................................................................................................................... | 19 | 1 | 121.00 | 1.00 | 58.00 | 5.00 | 8.00 | 8.00 | 8.00 | - | 2.00 | 5.00 | 2.00 | 3.00 | 3.00 | - | - | - | - | - | - | 2.00 | - | - | 2.00 | 1.00 | - | 2.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTGT........................................................................................................................................................... | 18 | 1 | 46.00 | 1.00 | 22.00 | - | - | 1.00 | - | - | 2.00 | 3.00 | 3.00 | 1.00 | 1.00 | - | 3.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTG............................................................................................................................................................ | 17 | 1 | 33.00 | 1.00 | 3.00 | 8.00 | - | - | - | 8.00 | 4.00 | - | - | - | - | 3.00 | - | 2.00 | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................CGTTCTGTCTCCTCCTGTAGA................................................. | 21 | 1 | 5.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTTT........................................................................................................................................................... | 18 | 1 | 4.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................TAGGGATCGGGTGGCGTTT......................................................................................................................................................... | 19 | 3.00 | 0.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................CGTTCTGTCTCCTCCTGTAG.................................................. | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................CCGTTCTGTCTCCTCCTGTAG.................................................. | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................AGAGGGAGCTGGGAGCCTG................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................ACAGGGGAGAGGGAGCCTGT....................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................CAATGGCCGTTCTGTCTCCTCCTGTAG.................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGT............................................................................................................................................................. | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................AGGGGAGAGGGAGCTGGGAGCGTC................................................................................................................................................................................. | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CTAGGGATCGGGTGGTGC........................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................GCCGCCGGGGCAGGGCGA............................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CCCAAAGTCAGACGATC............................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CTAGGGATCGGGTGGGGGG.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTGGT.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGG.............................................................................................................................................................. | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTTTT.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGTGCT.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...CAGCCTGGGCAGCACAGGC...................................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CTAGGGATCGGGTGGTGTC.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGCGTT.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GAGGGGCTGGAAGCAAAAC.................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................CTAGGGATCGGGTGGC............................................................................................................................................................. | 16 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGGGT........................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................TGGCCGTTCTGTCTCCTCCTGTAGA................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................CGGGTGGCAGAGGAGTAGGG................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................GTTCTGTCTCCTCCTGTAG.................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................CTGAGGAGGCCAATGTTC..................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................CCCAAAGTCAGACGAGCCG........................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................................TCTGTCCTCCTGCTGTGG......... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................GTTGCTGCCGCCGGGGTC................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................AAAGTCAGACGAGGGCTCTGT...................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................CTAGGGATCGGGTGGAGTT.......................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GAGGGGCTGGAAGCAGGTGTTG................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................CAGACGAGGGCTCTG....................... | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - |
| ........................................................................................................GGGTGGCAGAGGAGTC.................................................................................................................................................... | 16 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................GCTTCTCCTGGCCTGAGC.......................................................................................................................................................................................................................... | 18 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - |
| CAGCAGCCTGGGCAGCACAACATTCTGGGAGGGCTTCTCCTGGCCTGAGCGTAAGTGTCCCCAACACAGGGGAGAGGGAGCTGGGAGCCCAAGCCCTAGGGATCGGGTGGCAGAGGAGTCCCAGGGTGACCCCGAGGGGCTGGAAGCAGGTGTTGCTGCCGCCGGGGCAGGGGCTTCAGGGCTGAGGAGGCCAATGGCCGTTCTGTCTCCTCCTGTAGTTCGCCCAAAGTCAGACGAGGGCTCTGTCCTCCTGCTGCACCGAGCTTTG ..........................................................................................(((((((.....((.((((((((...((((((.(((....)))..))))))...(((....))).)))))))).))...)))))))(((((..((((.((((...))))......)))).)))))..................................................... ..........................................................................................91.............................................................................................................................218................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR189784 | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR343334 | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR040032(GSM532917) G603N. (cervix) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR040042(GSM532927) G428N. (cervix) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR040036(GSM532921) G243N. (cervix) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR343335 | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577738(Rovira) total RNA. (breast) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR040027(GSM532912) G220T. (cervix) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR037937(GSM510475) 293cand2. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................................................................................................................................................................TCCTGCTGCACCGAGCATA. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................GGTGTTGCTGCCGCCACC...................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CGCCGGGGCAGGGGCTCCA.......................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CGCCGGGGCAGGGGCACGG.......................................................................................... | 19 | 0.33 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.22 | - | 0.11 | - | - | |
| ...............................................................................................................................................................CGCCGGGGCAGGGGCCCA........................................................................................... | 18 | 0.11 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | |
| ...............................................................................................................................................................GCCCCTGCCCCGGCG.............................................................................................. | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................CGCCGGGGCAGGGGCACG........................................................................................... | 18 | 0.11 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - |