| (3) B-CELL | (12) BREAST | (5) CELL-LINE | (6) CERVIX | (1) HEART | (7) LIVER | (2) OTHER | (53) SKIN | (1) XRN.ip |
| TTTTCCTAAGGATCTTCTGTAACATCAAAGGAGGTGACCTAAGCAACCTCCAAATGGGGATCTTTGGAGTATGTCAGGGCCTTTGCCCCTGAGTGTTACAGCCCCTTGAGGTGGGCGGAGGGTAGGAGTGGTAGCAGAGCTGTGACCAGGGCTGTTCTCACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTCTGCAGGCACCAGTTGGAGATGCCAGGACATTACTCTCATCTGGCTGCCTTCTATG ..................................................................................((((((((..........((((((...)).)))))).)))))).((((..(((((..(((....)))..)))))..))))........................................................................................ .................................................................................82...............................................................................163..................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532876(GSM532876) G547T. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040029(GSM532914) G026T. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR040008(GSM532893) G727N. (cervix) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR029127(GSM416756) A549. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | TAX577453(Rovira) total RNA. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR040037(GSM532922) G243T. (cervix) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM532883(GSM532883) G871N. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191492(GSM715602) 154genomic small RNA (size selected RNA from . (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR191466(GSM715576) 114genomic small RNA (size selected RNA from . (breast) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191531(GSM715641) 134genomic small RNA (size selected RNA from . (breast) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR191393(GSM715503) 22genomic small RNA (size selected RNA from t. (breast) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................CCCTGAGTGTTACAGCCCCCCC.............................................................................................................................................. | 22 | 18.00 | 0.00 | 3.00 | - | 3.00 | - | 3.00 | 2.00 | - | 1.00 | 1.00 | - | - | 2.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................CCCCTGAGTGTTACAGCCCCCCC.............................................................................................................................................. | 23 | 1 | 11.00 | 1.00 | 4.00 | - | - | 1.00 | - | - | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCCC.............................................................................................................................................. | 18 | 6 | 9.50 | 3.67 | 0.17 | 1.33 | - | 0.17 | 0.33 | 0.17 | 0.17 | 0.17 | 0.50 | 0.50 | 0.33 | - | - | - | - | - | 0.17 | 0.17 | 0.33 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | 0.17 | - | 0.67 | - | 0.17 | 0.17 | 0.33 | 0.17 | 0.33 | - | 0.17 | 0.17 | - | - | 0.17 | 0.17 | - | - | 0.33 | 0.17 | 0.17 | 0.17 | - | - | - | - | 0.17 | - | 0.17 | 0.17 | - | 0.17 | - | - | - | - | 0.17 | - | 0.17 | - | - | - | - | - | - | 0.17 | - |
| ......................................................................................CCCTGAGTGTTACAGCCCCCC............................................................................................................................................... | 21 | 6.00 | 0.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................GAGTGTTACAGCCCCCCCG............................................................................................................................................. | 19 | 6 | 5.33 | 3.67 | - | 0.50 | - | 0.33 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | 0.17 | - | - | 0.17 | - | - | 0.17 | 0.33 | - | - | - | - | 0.33 | - | 0.17 | 0.17 | 0.17 | 0.17 | - | 0.17 | 0.17 | 0.17 | - | 0.17 | - | - | - | - | - | - | 0.17 | - | - | 0.17 | 0.17 | - | - | - | - | 0.17 | 0.17 | - | 0.17 | - | 0.17 | - | 0.17 |
| .....................................................................................CCCCTGAGTGTTACAGCCCCC................................................................................................................................................ | 21 | 1 | 4.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCC................................................................................................................................................. | 15 | 6 | 3.67 | 3.67 | - | - | - | - | - | 0.17 | - | - | 0.33 | - | - | 0.33 | - | - | - | - | 0.17 | 0.17 | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | 0.17 | 0.17 | - | 0.33 | 0.17 | - | - | - | - | - | - | - | - | 0.33 | - | - | 0.17 | 0.17 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | 0.17 | - | - | - |
| .....................................................................................CCCCTGAGTGTTACAGCCCCCC............................................................................................................................................... | 22 | 1 | 3.00 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CCTGAGTGTTACAGCCCCCCC.............................................................................................................................................. | 21 | 1 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................AGGACATTACTCTCATCTGGCTG......... | 23 | 1 | 3.00 | 3.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CCTGAGTGTTACAGCCCC................................................................................................................................................. | 18 | 1 | 2.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................ATTACTCTCATCTGGCTGCCTTCT... | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................CCCCTGAGTGTTACAGC.................................................................................................................................................... | 17 | 3 | 1.33 | 1.33 | 0.33 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................CCCTGAGTGTTACAGCCCTCCC.............................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................CCCCTGAGTGTTACAGCCCC................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................AGTGTTACAGCCCCTTCG............................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................TGAGGTGGGCGGAGGGTAGGAG.......................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CTGAGTGTTACAGCCCCC................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................CCAGTTGGAGATGCCAGGACA.......................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................ACATTACTCTCATCTGGCTGCCT...... | 23 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................GAGCTGTGACCAGGGCTGTTCTC........................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................ACATTACTCTCATCTGGCTGC........ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGCACCAGTTGGAGATGCCAGGA............................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CCTGAGTGTTACAGCCCCCC............................................................................................................................................... | 20 | 1 | 1.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................GTAGGAGTGGTAGCAGAGCTGTGACCAGGGC.................................................................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................TGGAGATGCCAGGACATTACT..................... | 21 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CTGAGTGTTACAGCCCC................................................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................GGAGATGCCAGGACATTACTCT................... | 22 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................GGGTAGGAGTGGTAGAGGC................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................AGCTGTGACCAGGGCACC............................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................CCCTGAGTGTTACAGCC................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CTGAGTGTTACAGCCCCCCC.............................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................TCATCTGGCTGCCTTCTAT. | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................ATGCCAGGACATTACTCTCACCT.............. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................CAGCCCCTTGAGGTGCGC...................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................ACATTACTCTCATCTGGCTGCCAT..... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................GCAGAGCTGTGACCAGGGCTGTT.............................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................CCCTGAGTGTTACAGCCCCC................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................GAGTGTTACAGCCCCCCCC............................................................................................................................................. | 19 | 6 | 0.83 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCCGG............................................................................................................................................. | 19 | 6 | 0.50 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................TGAGTGTTACAGCCCC................................................................................................................................................. | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCGG.............................................................................................................................................. | 18 | 6 | 0.33 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCTGG............................................................................................................................................. | 19 | 6 | 0.17 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCCG.............................................................................................................................................. | 18 | 6 | 0.17 | 3.67 | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCGG............................................................................................................................................... | 17 | 6 | 0.17 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCTT.............................................................................................................................................. | 18 | 6 | 0.17 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCTTT............................................................................................................................................. | 19 | 6 | 0.17 | 3.67 | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................GAGTGTTACAGCCCCCCT.............................................................................................................................................. | 18 | 6 | 0.17 | 3.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TTTTCCTAAGGATCTTCTGTAACATCAAAGGAGGTGACCTAAGCAACCTCCAAATGGGGATCTTTGGAGTATGTCAGGGCCTTTGCCCCTGAGTGTTACAGCCCCTTGAGGTGGGCGGAGGGTAGGAGTGGTAGCAGAGCTGTGACCAGGGCTGTTCTCACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTCTGCAGGCACCAGTTGGAGATGCCAGGACATTACTCTCATCTGGCTGCCTTCTATG ..................................................................................((((((((..........((((((...)).)))))).)))))).((((..(((((..(((....)))..)))))..))))........................................................................................ .................................................................................82...............................................................................163..................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR191592(GSM715702) 59genomic small RNA (size selected RNA from t. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM532876(GSM532876) G547T. (cervix) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040029(GSM532914) G026T. (cervix) | SRR040028(GSM532913) G026N. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR040008(GSM532893) G727N. (cervix) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR029127(GSM416756) A549. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | TAX577453(Rovira) total RNA. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR040037(GSM532922) G243T. (cervix) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM532883(GSM532883) G871N. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191492(GSM715602) 154genomic small RNA (size selected RNA from . (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR191466(GSM715576) 114genomic small RNA (size selected RNA from . (breast) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR191531(GSM715641) 134genomic small RNA (size selected RNA from . (breast) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR191393(GSM715503) 22genomic small RNA (size selected RNA from t. (breast) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................GTGGTAGCAGAGCTGTGACCAGGGCTGTTCCC........................................................................................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................TGACCAGGGCTGTTCAGG.......................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCGGAGGGTAGGAGTGCTG..................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GCCTTTGCCCCTGAGTTGC......................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................GTTCTCACTGTGTGTGAT............................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................GAGTGTTACAGCCCCTG............................................................................................................................................... | 17 | 6 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................ACAGCCCTGGTCACAG............................................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................CAGAAAAACACACACACACACACACACACACA..................................................... | 32 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |