| (3) BRAIN | (3) BREAST | (14) CELL-LINE | (1) CERVIX | (3) FIBROBLAST | (6) HEART | (2) HELA | (3) LIVER | (1) OTHER | (14) SKIN |
| GATTTCCCAGTAGACAGGGTATGACTGTAGGTTTAATTGTTGTTTCAATGTAGTGAAAAGTATAAATGCGTCAAGGTTGCCCTGAGAGAGCAAACAGAGATGAATATATGATGAGGAGCTTGGGACTGATGACCTAGAAAAATAGAACTCTTAAATTTTACTTTCTTAAAGTGATATAACTTGAGGGTATCTCAATTTAGGAAGTCTGTGCTGCCTTTGAAGCTAAAGAAGAAACATATAAGAGTCTGAT ...............................................................................................((((...........((.((..........)).))...(((......)))..))))................................................................................................... ..............................................................................................95...........................................................156............................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189782 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343336 | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR015447(SRR015447) nuclear small RNAs. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038860(GSM458543) MM426. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | GSM532876(GSM532876) G547T. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................ATATATGATGAGGAGCTTGGGACTGATG....................................................................................................................... | 28 | 1 | 39.00 | 39.00 | 13.00 | 11.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | 1.00 | - | - | - | 2.00 | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - |
| ......................................................................................................AATATATGATGAGGAGCTTGGGACTGATG....................................................................................................................... | 29 | 1 | 13.00 | 13.00 | 2.00 | - | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - |
| ......................................................................................................AATATATGATGAGGAGCTTGGGACTGATGA...................................................................................................................... | 30 | 1 | 3.00 | 3.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAAGTCTGTGCTGCCTTT................................ | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGTCTGTGCTGCCTTTGAAGC........................... | 23 | 1 | 2.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................TGTGCTGCCTTTGAAGCTAAAGAAGAAACA.............. | 30 | 1 | 2.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................ATATATGATGAGGAGCTTGGGACTGCTG....................................................................................................................... | 28 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................ATGAATATATGATGAGGAG.................................................................................................................................... | 19 | 1 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................ATATATGATGAGGAGCTTGGGACTGA......................................................................................................................... | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAAGTCTGTGCTGCCTTTGAAGCT.......................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................................AAAGAAGAAACATATAAGAGTCTGA. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................TCTGTGCTGCCTTTGAAGCTAAAGAAGAAAC............... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................AAGAAGAAACATATATTG....... | 18 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................CTAGAAAAATAGAACTCTG.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................TGTGCTGCCTTTGAAGCTAAAGAAGAAA................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................AGAAGAAACATATAAGAGTCTGA. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................TGTGCTGCCTTTGAAGCTAAAGA..................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................TGTGCTGCCTTTGAAGCTAAAGAAGAAAC............... | 29 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................AAGGTTGCCCTGAGAGAGC............................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAAGTCTGTGCTGCCTTTGAAGCTAAAGAAG................... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAAGTCTGTGCTGCCTTTGAA............................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................GAGGAGCTTGGGACTGCA........................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................GGGTATGACTGTAGGTTTA....................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................AAGAAGAAACATATAAGAGTCTG.. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGTCTGTGCTGCCTTTGAAGCTAAAGAAGA.................. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................TGTGCTGCCTTTGAAGCTAAAGAAG................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGTCTGTGCTGCCTTTGAAGCTA......................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................GAAGTCTGTGCTGCCTTT................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............CAGGGTATGACTGTAGGTTT........................................................................................................................................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................TCTGTGCTGCCTTTGAAGCT.......................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................GAGGAGCTTGGGACTGCAGG...................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................TGTAGGTTTAATTGTTG................................................................................................................................................................................................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................GATGAGGAGCTTGGGACTGATGACC.................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GGAAGTCTGTGCTGCCT.................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |
| GATTTCCCAGTAGACAGGGTATGACTGTAGGTTTAATTGTTGTTTCAATGTAGTGAAAAGTATAAATGCGTCAAGGTTGCCCTGAGAGAGCAAACAGAGATGAATATATGATGAGGAGCTTGGGACTGATGACCTAGAAAAATAGAACTCTTAAATTTTACTTTCTTAAAGTGATATAACTTGAGGGTATCTCAATTTAGGAAGTCTGTGCTGCCTTTGAAGCTAAAGAAGAAACATATAAGAGTCTGAT ...............................................................................................((((...........((.((..........)).))...(((......)))..))))................................................................................................... ..............................................................................................95...........................................................156............................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189782 | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343336 | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR015447(SRR015447) nuclear small RNAs. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191629(GSM715739) 5genomic small RNA (size selected RNA from to. (breast) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038860(GSM458543) MM426. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | GSM532876(GSM532876) G547T. (cervix) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................AATGTAGTGAAAAGTACTG......................................................................................................................................................................................... | 19 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................GAAAAATAGAACTCTATTG............................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................AATGTAGTGAAAAGTATTG......................................................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................................AAAGAAGAAACATATAAGGTTT.... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ..................................................TAGTGAAAAGTATAAATGATTT.................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ..............................................AATGTAGTGAAAAGTCC........................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ..............................................................................................................................................................................................................................CTAAAGAAGAAACATTAGC......... | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |