| (1) B-CELL | (1) BRAIN | (2) BREAST | (7) CELL-LINE | (2) CERVIX | (2) HEART | (1) LIVER | (2) OTHER | (1) RRP40.ip | (24) SKIN | (1) TESTES | (1) UTERUS |
| ACTGTAGCCAACCACTCTGTAAACTCTGTTTTTCCGTGGGCTTAAATTCTGGCATGACTGGGAAAGATTGAGACCCTAGAAAAGAACTTTGATGTATCTGATCTCCTGATTCTCCAGGATGAATGTATCCTGTCCATCCCATGCCCCGTAACTCCCACCTGCCTACCATCTTGATTCCTGCCCTTCTCCCTTGCCTACAGTCCAGTGCTCCCCAGGGCACTACTACAACACCAGCATCCACCGCTGTATT .........................................................(((((............)))))...(((((......)).)))....................................................................................................................................................... ..................................................51.................................................102.................................................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR191454(GSM715564) 180genomic small RNA (size selected RNA from . (breast) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR390723(GSM850202) total small RNA. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR040035(GSM532920) G001T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR189784 | SRR189783 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................AAAAGAACTTTGATGAGAG........................................................................................................................................................ | 19 | 59.00 | 0.00 | 33.00 | 8.00 | 2.00 | - | 1.00 | 2.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GAAAAGAACTTTGATGAGAG........................................................................................................................................................ | 20 | 3 | 9.00 | 0.33 | 4.33 | 0.67 | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.67 | - | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | - | - | - |
| ...............................................................................AAAAGAACTTTGATGAGA......................................................................................................................................................... | 18 | 3.00 | 0.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GAAAAGAACTTTGATAGAG......................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................TAGAAAAGAACTTTGAAG............................................................................................................................................................ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................AAAAGAACTTTGATGGCGA........................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................TCTGATCTCCTGATTCGCA....................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................TCCCTTGCCTACAGTCCAGGGA.......................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................TGACTGGGAAAGATTGAGAC................................................................................................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................AAAAGAACTTTGATGAGAA........................................................................................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................TAGAAAAGAACTTTGAAGAG.......................................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................ACCCTAGAAAAGAACTCTG............................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GAAAAGAACTTTGATGTGAGA....................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................AAAAGAACTTTGATGG........................................................................................................................................................... | 16 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................AAAGAACTTTGATGTAGGG....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................GAAAAGAACTTTGATGATAG........................................................................................................................................................ | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................GAAAAGAACTTTGATG............................................................................................................................................................ | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................GAAAAGAACTTTGATGAGGG........................................................................................................................................................ | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ....................................................................................................................................................................................................................CAGGGCACTACTACA....................... | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| ...................................................................................................................................................................................................TACAGTCCAGTGCTC........................................ | 15 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |
| ACTGTAGCCAACCACTCTGTAAACTCTGTTTTTCCGTGGGCTTAAATTCTGGCATGACTGGGAAAGATTGAGACCCTAGAAAAGAACTTTGATGTATCTGATCTCCTGATTCTCCAGGATGAATGTATCCTGTCCATCCCATGCCCCGTAACTCCCACCTGCCTACCATCTTGATTCCTGCCCTTCTCCCTTGCCTACAGTCCAGTGCTCCCCAGGGCACTACTACAACACCAGCATCCACCGCTGTATT .........................................................(((((............)))))...(((((......)).)))....................................................................................................................................................... ..................................................51.................................................102.................................................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR191454(GSM715564) 180genomic small RNA (size selected RNA from . (breast) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR390723(GSM850202) total small RNA. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR553576(SRX182782) source: Testis. (testes) | SRR189786 | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR040035(GSM532920) G001T. (cervix) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR189784 | SRR189783 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................ACCATCTTGATTCCTGCGTC.................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................AAGTTCTTTTCTAGGGTCT................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................TGGATGCTGGTGTTGTAGTAGT.......... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................TGCCCCGTAACTCCCACCTGCCTCGGG.................................................................................. | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................CCATCTTGATTCCTGCCCTTCTC.............................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGGAGAATCAGGAGATCA...................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................ATTCTCCAGGATGAAGTA............................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................GAGCACTGGACTGTAGGCAAGGGAGAAG........................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................GCACTGGACTGTAGGCAAGGG.......................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................GGAGCACTGGACTGTAGGCAA....................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............AACAGAGTTTACAGAGT............................................................................................................................................................................................................................ | 17 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - |