| (1) AGO2.ip | (5) B-CELL | (3) BRAIN | (11) BREAST | (26) CELL-LINE | (4) CERVIX | (1) FIBROBLAST | (2) HEART | (1) HELA | (2) LIVER | (1) OTHER | (9) SKIN | (2) UTERUS |
| CCCCTGGAGAGCAGGGACTACCTGGGACAGCTGGAAAAGAAGGAACAAAGGTCAGTGAGGGGCCAGGCAGAGGGGAAGTGGGGGAGCTGGGGATTGGGGTGCTGAAAGGAACAGGTAGTTGGAGATTTGAGGGGGGGCTGGAGAGCTCTCTGTTTAATTTGGGAGCATGGCTGTGGCTCATCACCTCTCCTTTCCTTTTAGGGTGACCCTGGTCCCCCTGGGGCCCCAGGGAAGGATGGTCCTGCTGGTCT ................................................................................((((((((...(((((..((.((....)).))...)))))......((.((......)).)).)))))))).................................................................................................... .............................................................................78..........................................................................154............................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189784 | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR029131(GSM416760) MCF7. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR040034(GSM532919) G001N. (cervix) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | TAX577740(Rovira) total RNA. (breast) | SRR038855(GSM458538) D10. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR191403(GSM715513) 44genomic small RNA (size selected RNA from t. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR040038(GSM532923) G531N. (cervix) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR038860(GSM458543) MM426. (cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191560(GSM715670) 77genomic small RNA (size selected RNA from t. (breast) | SRR191619(GSM715729) 166genomic small RNA (size selected RNA from . (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577738(Rovira) total RNA. (breast) | SRR038853(GSM458536) MELB. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................GGAGCTGGGGATTGGGGGT...................................................................................................................................................... | 19 | 1 | 51.00 | 3.00 | 5.00 | - | 1.00 | 3.00 | 2.00 | 4.00 | 2.00 | 2.00 | 3.00 | 1.00 | 2.00 | - | - | 1.00 | 2.00 | 2.00 | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - |
| ..................................................................................GGAGCTGGGGATTGGGGG....................................................................................................................................................... | 18 | 1 | 6.00 | 3.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................GAGCTGGGGATTGGGGGT...................................................................................................................................................... | 18 | 5.00 | 0.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................GGAGCTGGGGATTGGGGGTT..................................................................................................................................................... | 20 | 1 | 4.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GGGAGCTGGGGATTGTGGG....................................................................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................GGAGCTGGGGATTGGGG........................................................................................................................................................ | 17 | 1 | 3.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GGAGCTGGGGATTGGGGGA...................................................................................................................................................... | 19 | 1 | 2.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GGGAGCTGGGGATTGTGG........................................................................................................................................................ | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................GCTGGGGATTGGGGTTTGC................................................................................................................................................... | 19 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................GCTGGGGATTGGGGTTGCA................................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................CTGGGACAGCTGGAAAAGAAGGAA.............................................................................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GGAGCTGGGGATTGGGGGG...................................................................................................................................................... | 19 | 1 | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................GGGAGCTGGGGATTGTCG........................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................GGGGAAGTGGGGGAGCTCCG................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................AGCTGGGGATTGGGGGTAA.................................................................................................................................................... | 19 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................CTGGGACAGCTGGAAAAGAAGGA............................................................................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GGAGCTGGGGATTGGAAC....................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ..................................................................................GGAGCTGGGGATTGGGGGTTT.................................................................................................................................................... | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ...................................................................................GAGCTGGGGATTGGGGG....................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................AGCTGGGGATTGGGG........................................................................................................................................................ | 15 | 0 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................GGGGGGGCTGGAGAGCCCGT..................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAGAAGGAACAAAG......................................................................................................................................................................................................... | 16 | 0 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GGAGCTGGGGATTGGGGT....................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................AGCTGGGGATTGGGGGTTC.................................................................................................................................................... | 19 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................................GATGGTCCTGCTGGTGCT | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................AGCTGGAAAAGAAGGACATA........................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................GGAGCTGGGGATTGGG......................................................................................................................................................... | 16 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| .....................................................................................................................GTTGGAGATTTGAGGG...................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| CCCCTGGAGAGCAGGGACTACCTGGGACAGCTGGAAAAGAAGGAACAAAGGTCAGTGAGGGGCCAGGCAGAGGGGAAGTGGGGGAGCTGGGGATTGGGGTGCTGAAAGGAACAGGTAGTTGGAGATTTGAGGGGGGGCTGGAGAGCTCTCTGTTTAATTTGGGAGCATGGCTGTGGCTCATCACCTCTCCTTTCCTTTTAGGGTGACCCTGGTCCCCCTGGGGCCCCAGGGAAGGATGGTCCTGCTGGTCT ................................................................................((((((((...(((((..((.((....)).))...)))))......((.((......)).)).)))))))).................................................................................................... .............................................................................78..........................................................................154............................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189784 | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR029131(GSM416760) MCF7. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR040034(GSM532919) G001N. (cervix) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | TAX577740(Rovira) total RNA. (breast) | SRR038855(GSM458538) D10. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR191403(GSM715513) 44genomic small RNA (size selected RNA from t. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR040038(GSM532923) G531N. (cervix) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR038860(GSM458543) MM426. (cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191560(GSM715670) 77genomic small RNA (size selected RNA from t. (breast) | SRR191619(GSM715729) 166genomic small RNA (size selected RNA from . (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577738(Rovira) total RNA. (breast) | SRR038853(GSM458536) MELB. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................................TGGCTCATCACCTCTCCTTCCC........................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ......................................................................................................................................................................................ACCTCTCCTTTCCTTTCAG.................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................GGGGGGCTGGAGAGCGATT..................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................GGGCTGGAGAGCTCTAACG.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................ATTGGGGTGCTGAAAATTG............................................................................................................................................ | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................GGGAGCTGGGGATTGTCTG....................................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................GTGACCCTGGTCCCCCTTGCC............................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................GGGCTGGAGAGCTCTGACG.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................GGGCTGGAGAGCTCTCGA................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................GGGGGGCTGGAGAGCTGGC..................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................CCCCACTTCCCCTCTGC........................................................................................................................................................................ | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |