| (1) AGO2.ip | (1) AGO3.ip | (8) B-CELL | (2) BRAIN | (1) BREAST | (18) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (1) HEART | (8) HELA | (2) LIVER | (2) OTHER | (6) SKIN | (2) UTERUS | (1) XRN.ip |
| TGAACAGCAACCTGGATCCCAGCGAGGTGGAGAAGGCCAAAGAAGGGCAGGTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAGAAAGCTGACTTCCCAGCGGGGATTCCTGAATGTGGCACCGATGCTCTCCG ..................................................................................((((...(((.(((((.((..((((.....))))..)).))))).))))))).................................................... ............................................................................77.........................................................136................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR038852(GSM458535) QF1160MB. (cell line) | DRR001482(DRX001036) "Hela long total cell fraction, control". (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR040041(GSM532926) G612T. (cervix) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | GSM532874(GSM532874) G699T. (cervix) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR038854(GSM458537) MM653. (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR038859(GSM458542) MM386. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................GTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAG.................................................. | 86 | 1 | 69.00 | 69.00 | 50.00 | 16.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................TGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAG.................................................. | 83 | 1 | 4.00 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CACAGCGTGGATGGGGCTGGCTGA................................................................................. | 24 | 1 | 3.00 | 3.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAG.................................................. | 85 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTATGGAGGGTTGGGCTGGGCTAAAA.............................................................................................................. | 26 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................CGAGGTGGAGAAGGCCAAAGAAGGG........................................................................................................................................... | 25 | 1 | 2.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................AGCGTGGATGGGGCTGGCTGAAG............................................................................... | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................CGTGGATGGGGCTGGCTG.................................................................................. | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................TGGAGGGTTGGGCTGGGCT.................................................................................................................. | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................CAGGTATGGAGGGTTGGGCTGGG.................................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................TGGATGGGGCTGGCTGAGGACGCT.......................................................................... | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................TGTAGAAAGCTGACTCATT.................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................TGGAGGGTTGGGCTGGGCTAA................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ....................................................................................................................CCCCTGCCTCTTCCCTGTAGA................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................TGGAGGGTTGGGCTGGGCTAAGCA............................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................CTGAATGTGGCACCGATG....... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................GGGATTCCTGAATGTGGC.............. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CCCCTGCCTCTTCCCTGTAG.................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....AGCAACCTGGATCCCCTC................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........CCTGGATCCCAGCGAGGTGGAG.......................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................AGCGGGGATTCCTGAATGTGGCACCG.......... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................GAGGGTTGGGCTGGGCTC................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................GCGGGGATTCCTGAATGTGGCACC........... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................TGGCACCGATGCTCTGGA | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................CAGCGAGGTGGAGAAGGCC.................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .....................................................TGGAGGGTTGGGCTGGGCTAAG............................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ......................................................GGAGGGTTGGGCTGGGCT.................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................GTGGATGGGGCTGGCCCCG................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................GATTCCTGAATGTGGCACCGATGCTCTTC. | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTATGGAGGGTTGGGCTGGGCTA................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................CAGCGTGGATGGGGCTGGC.................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................GGAGGGTTGGGCTGGGCTAAG............................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................GGGTTGGGCTGGGCTAAAA.............................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................TGGATGGGGCTGGCTGAGGACT............................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................AGCGGGGATTCCTGAATGTGGCA............. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................TGGATGGGGCTGGCTGATAA.............................................................................. | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TGGCTGAGGACGCTCCTCCGTA.................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................AGCGAGGTGGAGAAGGCCAAAGAAGGGCAG........................................................................................................................................ | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGGGCTGGCTGAGGAAAAA.......................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGCAG.................................................. | 86 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................AGGTGGAGAAGGCCAGCAG............................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................TGGAGGGTTGGGCTGGGC................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .....................................................TGGAGGGTTGGGCTGGGCTT................................................................................................................. | 20 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..................................................GTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCA............................................................. | 75 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................GCGTGGATGGGGCTGGCTG.................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................AGAAGGCCAAAGAAGGGCAGGT...................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................CTGGCTGAGGACGCTCCTCCTCC.................................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................ATGGGGCTGGCTGAGGAC............................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAA.................................................. | 86 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TTCCCTGTAGAAAGCTGA.......................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - |
| .......................................................................................GTGGATGGGGCTGGCTG.................................................................................. | 17 | 5 | 0.40 | 0.40 | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - |
| ................................................................................................................CCTCCCCCTGCCTCTTCC........................................................ | 18 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - |
| .............................GAGAAGGCCAAAGAAG............................................................................................................................................. | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - |
| TGAACAGCAACCTGGATCCCAGCGAGGTGGAGAAGGCCAAAGAAGGGCAGGTATGGAGGGTTGGGCTGGGCTAAGCAGGAGCACAGCGTGGATGGGGCTGGCTGAGGACGCTCCTCCCCCTGCCTCTTCCCTGTAGAAAGCTGACTTCCCAGCGGGGATTCCTGAATGTGGCACCGATGCTCTCCG ..................................................................................((((...(((.(((((.((..((((.....))))..)).))))).))))))).................................................... ............................................................................77.........................................................136................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR038852(GSM458535) QF1160MB. (cell line) | DRR001482(DRX001036) "Hela long total cell fraction, control". (hela) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR040041(GSM532926) G612T. (cervix) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | GSM532874(GSM532874) G699T. (cervix) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR038854(GSM458537) MM653. (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR038859(GSM458542) MM386. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................GCACAGCGTGGATGGAGGC....................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................TCCTCCCCCTGCCTCTTTTT....................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................CCCTGCCTCTTCCCTGTTGGG................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................TCCCTGTAGAAAGCTCAGG........................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................AGGGAAGAGGCAGGGGG...................................................... | 17 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |