| (1) AGO1.ip | (4) AGO2.ip | (13) B-CELL | (3) BRAIN | (7) BREAST | (13) CELL-LINE | (2) HEART | (3) HELA | (1) KIDNEY | (5) LIVER | (1) OTHER | (15) SKIN | (1) XRN.ip |
| TAAAGAAGAGACGTCGGGCCCAGGGGGAACAGGCACGAGCTGAACTCTTGGTAAGGGTTGTTGGAATTCACAGTTGGTTCTGCTGGTGCTCTCCTCTTCTGTAGAGCTGATGTTACTTCCCTTAAACTTGTCCAGCATGTCACCCAGAACTTGTAGGTAGAGGTGGATCAACCGCACATGGCAGTGGGAACTCACCCGGAGAACTAAGATTCCCTTACTTTTGGGGAAAGCATGGAGAAGCCAAGTTTGG ......................................................(((((((((((.......((..(((((((.((......))......)))))))..))...................)))))))....))))..........(((.((......)).)))............................................................................. ..................................................51.........................................................................................................................174.......................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | TAX577580(Rovira) total RNA. (breast) | TAX577588(Rovira) total RNA. (breast) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR189782 | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | TAX577745(Rovira) total RNA. (breast) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........CGTCGGGCCCAGGGGAG.............................................................................................................................................................................................................................. | 17 | 32.00 | 0.00 | 25.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ........................................................................................................................................................GTAGGTAGAGGTGGACTG................................................................................ | 18 | 16.00 | 0.00 | - | 1.00 | 6.00 | 5.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................TGTAGGTAGAGGTGGACT................................................................................. | 18 | 8.00 | 0.00 | - | 1.00 | - | - | - | - | - | 3.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................GTAGGTAGAGGTGGACT................................................................................. | 17 | 5.00 | 0.00 | - | 4.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................GTAGGTAGAGGTGGACTGG............................................................................... | 19 | 5.00 | 0.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| .......................................................................................................................................................TGTAGGTAGAGGTGGACTG................................................................................ | 19 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........CGTCGGGCCCAGGGGA............................................................................................................................................................................................................................... | 16 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................GGGAACAGGCACGAGCTGAA.............................................................................................................................................................................................................. | 20 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......GAGACGTCGGGCCCATAC................................................................................................................................................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........CGTCGGGCCCAGGGGAGG............................................................................................................................................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................TGTAGGTAGAGGTGGACTGG............................................................................... | 20 | 2.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................GAACAGGCACGAGCTGAACTCTTG........................................................................................................................................................................................................ | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..................................................GTAAGGGTTGTTGGAATTCACAGTTGG............................................................................................................................................................................. | 27 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................GCACGAGCTGAACTCTTG........................................................................................................................................................................................................ | 18 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - |
| ....GAAGAGACGTCGGGCCCAG................................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....GAAGAGACGTCGGGCCC..................................................................................................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ............................ACAGGCACGAGCTGAACTCTTT........................................................................................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................CAGGCACGAGCTGAACTCTTG........................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................GGGAACAGGCACGAGCTGAACTCTTGAG...................................................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................GGGAACAGGCACGAGCTGAACTCTTG........................................................................................................................................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................AACAGGCACGAGCTGAACTCTTGG....................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ..................................................GTAAGGGTTGTTGGAGA....................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................GAACAGGCACGAGCTGAACTCTTGAG...................................................................................................................................................................................................... | 26 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................TGGTAAGGGTTGTTGGAAT....................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................AGAACTTGTAGGTAGAGGTG..................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............CGGGCCCAGGGGGAACAGGCACGAGCTG................................................................................................................................................................................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................GGAACAGGCACGAGCTGAACTCTTGA....................................................................................................................................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...AGAAGAGACGTCGGGCCCAGGGGGAAC............................................................................................................................................................................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................GCACGAGCTGAACTCTTGAGCC.................................................................................................................................................................................................... | 22 | 2 | 1.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............GTCGGGCCCAGGGGGGGGG........................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTAAGGGTTGTTGGAATTCACA.................................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................TTGGTTCTGCTGGTGTAG............................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................CACCCGGAGAACTAACC......................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................AACAGGCACGAGCTGAACT............................................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ..................................ACGAGCTGAACTCTTGGTAAG................................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................GGGGAACAGGCACGAGCTGAA.............................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........CGTCGGGCCCAGGGGGG.............................................................................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTAAGGGTTGTTGGAATT...................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .AAAGAAGAGACGTCGGGCCCAGGGGG............................................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................AGGCACGAGCTGAACTCTTGAGCC.................................................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................CGAGCTGAACTCTTGGTAAGG.................................................................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................GGGGGAACAGGCACGAGCT................................................................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........AGACGTCGGGCCCAGGGGGAACAGG......................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ...AGAAGAGACGTCGGGCCCAG................................................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................AGGTAGAGGTGGATCATG.............................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............GTCGGGCCCAGGGGGAACAGGCACGAGCTGAA.............................................................................................................................................................................................................. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........GACGTCGGGCCCAGGGGG............................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................GGGGGAACAGGCACGAGCTGAACT............................................................................................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ................................................................................................TTCTGTAGAGCTGATGTTACTTCCC................................................................................................................................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................CTGCTGGTGCTCTCCTCTTCT...................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CCCTTACTTTTGGGGAAAGCATGGAGAAGCC........ | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............TCGGGCCCAGGGGGA.............................................................................................................................................................................................................................. | 15 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| ................................GCACGAGCTGAACTCTT......................................................................................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................CCAGGGGGAACAGGC........................................................................................................................................................................................................................ | 15 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TAAAGAAGAGACGTCGGGCCCAGGGGGAACAGGCACGAGCTGAACTCTTGGTAAGGGTTGTTGGAATTCACAGTTGGTTCTGCTGGTGCTCTCCTCTTCTGTAGAGCTGATGTTACTTCCCTTAAACTTGTCCAGCATGTCACCCAGAACTTGTAGGTAGAGGTGGATCAACCGCACATGGCAGTGGGAACTCACCCGGAGAACTAAGATTCCCTTACTTTTGGGGAAAGCATGGAGAAGCCAAGTTTGG ......................................................(((((((((((.......((..(((((((.((......))......)))))))..))...................)))))))....))))..........(((.((......)).)))............................................................................. ..................................................51.........................................................................................................................174.......................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | TAX577580(Rovira) total RNA. (breast) | TAX577588(Rovira) total RNA. (breast) | SRR191587(GSM715697) 50genomic small RNA (size selected RNA from t. (breast) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR189782 | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | TAX577745(Rovira) total RNA. (breast) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................GTTGGTTCTGCTGGTGCTTG.............................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...AGAAGAGACGTCGGGCGC..................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |