ID: uc003ifw.1_intron_0_0_chr4_128982557_f.3p
GENE: LARP1B(1)
chr4:128995415-128995664+


(1)
AGO2.ip 		(25)
B-CELL 		(54)
BREAST 		(67)
CELL-LINE 		(2)
CERVIX 		(5)
FIBROBLAST 		(2)
HEART 		(3)
HELA 		(1)
KIDNEY 		(11)
LIVER 		(1)
OTHER 		(2)
RRP40.ip 		(45)
SKIN 		(4)
UTERUS 		(2)
XRN.ip

Sense strand
TTCTTGATTTGGAGACTGAAGATCACCTTGAATCTATGTGTCAAATGGGGTTGATTTTTTGCTAGGAATTTAAGTCTCAGAACCTTGGATTTTGGTTGGAAATGATGATTATACTGATTTACTGAAATTGACATAATAGTTATTTTGTTGAATTTATTGAATGAAGTAGTTGTAAAAACAATTCTATATATTTTCTTTAGAATTCGGTTCCCTCAAAATTATAAAGGCAGGAAAGCTCAAGACAAAGAAA
..................................................................................................((((((((.(((((..((((((....))))))..))))).))))))))........................................................................................................
............................................................................................93..............................................................157...........................................................................................
SizePerfect hitTotal NormPerfect NormSRR037943(GSM510481)
293DcrTN. (cell line)		SRR037941(GSM510479)
293DroshaTN. (cell line)		SRR363675(GSM830252)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR037937(GSM510475)
293cand2. (cell line)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR037939(GSM510477)
293cand5_rep1. (cell line)		SRR037938(GSM510476)
293Red. (cell line)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR037935(GSM510473)
293cand3. (cell line)		SRR037936(GSM510474)
293cand1. (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR033713(GSM497058)
Burkitt Lymphoma (BL115). (B cell)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		SRR207116(GSM721078)
Nuclear RNA. (cell line)		SRR037931(GSM510469)
293GFP. (cell line)		SRR029127(GSM416756)
A549. (cell line)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR029125(GSM416754)
U2OS. (cell line)		DRR001489(DRX001043)
"Hela short nuclear cell fraction, control". (hela)		SRR029129(GSM416758)
SW480. (cell line)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR038861(GSM458544)
MM466. (cell line)		SRR033714(GSM497059)
Burkitt Lymphoma (BL134). (B cell)		SRR033718(GSM497063)
Multiple Myeloma (U266). (B cell)		SRR207112(GSM721074)
RRP40 knockdown. (RRP40 cell line)		SRR330868(SRX091706)
tissue: skin psoriatic involveddisease state:. (skin)		SRR033731(GSM497076)
h929 Cell line (h929). (B cell)		SRR038860(GSM458543)
MM426. (cell line)		SRR039190(GSM494809)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR033732(GSM497077)
bjab cell line (bjab103). (B cell)		SRR330865(SRX091703)
tissue: skin psoriatic involveddisease state:. (skin)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR039192(GSM494811)
K562 cell line is derived from a CML patient . (cell line)		SRR015447(SRR015447)
nuclear small RNAs. (breast)		SRR029124(GSM416753)
HeLa. (hela)		SRR033721(GSM497066)
Ly3 cell line (Ly3). (B cell)		SRR029128(GSM416757)
H520. (cell line)		SRR330877(SRX091715)
tissue: skin psoriatic involveddisease state:. (skin)		SRR363674(GSM830251)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR033716(GSM497061)
Mentle Cell Lymphoma (MCL114). (B cell)		SRR330870(SRX091708)
tissue: skin psoriatic involveddisease state:. (skin)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR060982(GSM569186)
Human centrocyte [09-001]. (cell line)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR029130(GSM416759)
DLD2. (cell line)		SRR037932(GSM510470)
293cand4_rep1. (cell line)		SRR038859(GSM458542)
MM386. (cell line)		SRR330878(SRX091716)
tissue: skin psoriatic involveddisease state:. (skin)		GSM416733(GSM416733)
HEK293. (cell line)		SRR330858(SRX091696)
tissue: skin psoriatic involveddisease state:. (skin)		SRR029131(GSM416760)
MCF7. (cell line)		SRR330864(SRX091702)
tissue: skin psoriatic involveddisease state:. (skin)		SRR060981(GSM569185)
Human centroblast [09-001]. (cell line)		SRR330889(SRX091727)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR390723(GSM850202)
total small RNA. (cell line)		SRR330861(SRX091699)
tissue: skin psoriatic involveddisease state:. (skin)		SRR033712(GSM497057)
Burkitt Lymphoma (BL510). (B cell)		SRR033715(GSM497060)
Mantle Cell Lymphoma (Mino122). (B cell)		SRR038863(GSM458546)
MM603. (cell line)		SRR015446(SRR015446)
smallRNAs high-throughput sequencing Total. (breast)		DRR001488(DRX001042)
"Hela short nuclear cell fraction, LNA(+)". (hela)		SRR038855(GSM458538)
D10. (cell line)		SRR107296(GSM677703)
18-30nt fraction of small RNA. (cell line)		SRR060168(GSM565978)
5-8F_nucleus. (cell line)		SRR326282(GSM769512)
"Dicer mRNA was knocked down using siDicer, t. (cell line)		SRR363673(GSM830250)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR326280(GSM769510)
total cell content of unperturbed cells was s. (cell line)		SRR060983(GSM569187)
Human pre-germinal center B cell [09-001]. (cell line)		SRR330879(SRX091717)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330872(SRX091710)
tissue: skin psoriatic involveddisease state:. (skin)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330873(SRX091711)
tissue: skin psoriatic involveddisease state:. (skin)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR330880(SRX091718)
tissue: skin psoriatic involveddisease state:. (skin)		TAX577745(Rovira)
total RNA. (breast)		SRR094129(GSM651905)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330857(SRX091695)
tissue: skin psoriatic involveddisease state:. (skin)		SRR094132(GSM651908)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR038854(GSM458537)
MM653. (cell line)		SRR330871(SRX091709)
tissue: skin psoriatic involveddisease state:. (skin)		SRR189784SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		SRR330863(SRX091701)
tissue: skin psoriatic involveddisease state:. (skin)		SRR029126(GSM416755)
143B. (cell line)		SRR330859(SRX091697)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330862(SRX091700)
tissue: skin psoriatic involveddisease state:. (skin)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR330921(SRX091759)
tissue: normal skindisease state: normal. (skin)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		SRR033717(GSM497062)
Mentle Cell Lymphoma (MCL112). (B cell)		SRR330923(SRX091761)
tissue: normal skindisease state: normal. (skin)		SRR191631(GSM715741)
75genomic small RNA (size selected RNA from t. (breast)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR038858(GSM458541)
MEL202. (cell line)		SRR330860(SRX091698)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330902(SRX091740)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR038856(GSM458539)
D11. (cell line)		SRR038862(GSM458545)
MM472. (cell line)		SRR191607(GSM715717)
192genomic small RNA (size selected RNA from . (breast)		SRR330867(SRX091705)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191614(GSM715724)
92genomic small RNA (size selected RNA from t. (breast)		SRR015359(GSM380324)
Germinal Center B cell (GC136). (B cell)		SRR107297(GSM677704)
18-30nt fraction of small RNA. (cell line)		SRR191590(GSM715700)
48genomic small RNA (size selected RNA from t. (breast)		SRR191608(GSM715718)
193genomic small RNA (size selected RNA from . (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		SRR037876(GSM522374)
fibroblasts_cell_culture. (fibroblast)		TAX577739(Rovira)
total RNA. (breast)		SRR343335SRR038857(GSM458540)
D20. (cell line)		SRR330876(SRX091714)
tissue: skin psoriatic involveddisease state:. (skin)		SRR039611(GSM531974)
Human Normal Liver Tissue Sample 1. (liver)		SRR038852(GSM458535)
QF1160MB. (cell line)		GSM359208(GSM359208)
hepg2_bindASP_hl_2. (cell line)		SRR039614(GSM531977)
HBV-infected Liver Tissue. (liver)		SRR094130(GSM651906)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR191599(GSM715709)
89genomic small RNA (size selected RNA from t. (breast)		SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR207118(GSM721080)
RRP40 knockdown. (RRP40 cell line)		SRR191606(GSM715716)
84genomic small RNA (size selected RNA from t. (breast)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191610(GSM715720)
195genomic small RNA (size selected RNA from . (breast)		SRR039612(GSM531975)
Human Normal Liver Tissue Sample 2. (liver)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR015365(GSM380330)
Memory B cells (MM139). (B cell)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039613(GSM531976)
Human Normal Liver Tissue Sample 3. (liver)		GSM541796(GSM541796)
undifferentiated human embryonic stem cells. (cell line)		SRR033730(GSM497075)
Lymphoblastic (ALL411). (B cell)		TAX577453(Rovira)
total RNA. (breast)		SRR330916(SRX091754)
tissue: normal skindisease state: normal. (skin)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR189781(GSM714641)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR343334SRR033719(GSM497064)
6hr Activated B cell line (ABC158). (B cell)		SRR191488(GSM715598)
14genomic small RNA (size selected RNA from t. (breast)		SRR029054(GSM402329)
MCF7_smallRNAseq. (cell line)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR191555(GSM715665)
195genomic small RNA (size selected RNA from . (breast)		SRR330908(SRX091746)
tissue: normal skindisease state: normal. (skin)		SRR330914(SRX091752)
tissue: normal skindisease state: normal. (skin)		SRR330881(SRX091719)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		SRR330913(SRX091751)
tissue: normal skindisease state: normal. (skin)		SRR342894(SRX096790)
small RNA seq of Right atrial tissue. (heart)		SRR191435(GSM715545)
172genomic small RNA (size selected RNA from . (breast)		SRR553575(SRX182781)
source: Kidney. (Kidney)		SRR191586(GSM715696)
197genomic small RNA (size selected RNA from . (breast)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR191468(GSM715578)
116genomic small RNA (size selected RNA from . (breast)		GSM532880(GSM532880)
G659T. (cervix)		SRR330922(SRX091760)
tissue: normal skindisease state: normal. (skin)		SRR330890(SRX091728)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191482(GSM715592)
5genomic small RNA (size selected RNA from to. (breast)		SRR326279(GSM769509)
cytoplasmic fraction was isolated using PARIS. (cell line)		SRR191492(GSM715602)
154genomic small RNA (size selected RNA from . (breast)		SRR330891(SRX091729)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191577(GSM715687)
93genomic small RNA (size selected RNA from t. (breast)		SRR191493(GSM715603)
155genomic small RNA (size selected RNA from . (breast)		SRR191444(GSM715554)
109genomic small RNA (size selected RNA from . (breast)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR444049(SRX128897)
Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR040023(GSM532908)
G575T. (cervix)		SRR330911(SRX091749)
tissue: normal skindisease state: normal. (skin)		SRR015358(GSM380323)
NaÌøve B Cell (Naive39). (B cell)		SRR039617(GSM531980)
HBV(+) Adjacent Tissue Sample 1. (liver)		SRR189785SRR330897(SRX091735)
tissue: skin psoriatic uninvolveddisease stat. (skin)		GSM359193(GSM359193)
HepG2_3pM_7. (cell line)		SRR330875(SRX091713)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		SRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		SRR330887(SRX091725)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR033727(GSM497072)
HIV-positive DL (HIV412). (B cell)		TAX577741(Rovira)
total RNA. (breast)		SRR191495(GSM715605)
159genomic small RNA (size selected RNA from . (breast)		SRR330919(SRX091757)
tissue: normal skindisease state: normal. (skin)		SRR363676(GSM830253)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR330901(SRX091739)
tissue: skin psoriatic uninvolveddisease stat. (skin)		TAX577742(Rovira)
total RNA. (breast)		SRR033720(GSM497065)
EBV activated B cell line (EBV159). (B cell)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		TAX577589(Rovira)
total RNA. (breast)		SRR060169(GSM565979)
5-8F_cytoplasm. (cell line)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR330915(SRX091753)
tissue: normal skindisease state: normal. (skin)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191585(GSM715695)
196genomic small RNA (size selected RNA from . (breast)		SRR015360(GSM380325)
Plasma B cells (PC137). (B cell)		SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR038853(GSM458536)
MELB. (cell line)		SRR191458(GSM715568)
28genomic small RNA (size selected RNA from t. (breast)		SRR330866(SRX091704)
tissue: skin psoriatic involveddisease state:. (skin)		SRR342898(SRX096794)
small RNA seq of Right atrial tissue. (heart)		SRR191601(GSM715711)
58genomic small RNA (size selected RNA from t. (breast)		SRR015361(GSM380326)
Memory B cells (MM55). (B cell)		SRR191562(GSM715672)
82genomic small RNA (size selected RNA from t. (breast)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR330895(SRX091733)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039637(GSM518474)
THP1_total_sRNAs. (cell line)		SRR191497(GSM715607)
17genomic small RNA (size selected RNA from t. (breast)		SRR039624(GSM531987)
HBV(-) HCV(-) Adjacent Tissue Sample. (liver)		SRR207119(GSM721081)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		TAX577743(Rovira)
total RNA. (breast)		SRR191413(GSM715523)
28genomic small RNA (size selected RNA from t. (breast)		SRR189778(GSM714638)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR444060(SRX128908)
Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)
.................................................................................................GGAAATGATGATTATACTGATT...................................................................................................................................2216657.006657.00978.001006.00740.00727.00556.00500.00337.00290.00350.005.00210.00160.0014.001.006.0092.0059.0053.0063.0059.0053.0016.0043.005.002.001.00---14.00--5.002.0011.004.00-6.0017.003.0024.0012.0025.00-11.005.007.00--1.0023.0012.00-12.008.001.0014.0012.00-6.00--2.00-1.00-1.003.00---2.008.001.00-6.006.001.001.00-3.00--1.00--2.002.00-1.002.002.001.00-1.00-3.00--3.00--3.00---2.00-2.00--1.001.003.00----1.00--1.00--1.00-1.00--2.00-2.00---1.00----1.00--1.00----1.00-1.00-----1.00-1.00-1.001.00-------1.001.00---1.00-1.001.001.00-----1.00-------1.00---------1.001.00---1.00----1.00-1.00------1.00--
................................................................................................TGGAAATGATGATTATACTGATT...................................................................................................................................2312304.002304.0028.0063.00201.0017.0029.003.0018.0014.0015.00276.0013.005.00149.00144.00130.0021.005.006.002.00-6.0041.002.0037.0035.0042.0041.0038.00-26.0041.0034.0030.0035.0022.0032.0026.0025.008.0031.006.0020.003.0027.0019.0024.0018.0023.0026.0025.00-1.0021.008.001.0016.002.007.0015.0010.00-17.0015.0016.006.0010.0010.004.0012.0011.0012.0010.003.0011.0010.004.004.001.007.006.005.008.001.006.00-7.005.00-3.005.00-3.004.003.001.004.001.003.003.00-2.004.001.003.003.003.001.003.001.001.003.001.002.00-3.003.00-2.002.003.002.001.002.001.00-2.001.002.001.00-2.00-1.001.002.001.002.002.001.001.001.002.001.001.00---1.00---1.00-1.001.00----1.00--1.00-1.001.001.001.001.00--1.001.001.00-1.00---1.00--1.001.00-1.001.001.001.00-1.001.00-1.001.001.001.001.00------1.001.001.00-1.001.001.001.00-----1.001.00-1.00---
....................................................................................................AATGATGATTATACTGATT...................................................................................................................................191517.00517.0096.0026.00-65.0072.0048.0030.0034.0014.00-16.0025.00-1.00--18.0019.0013.0015.001.00-8.00----1.00----------2.00-1.00----------2.00--3.00-3.00----------2.00--------------------------------------------------------1.00-------1.00-------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTT..................................................................................................................................241134.00134.0018.004.002.003.00-3.0012.0018.00-13.00---3.003.00-1.004.00--1.00--1.001.00-1.002.001.00-1.002.001.001.00-1.001.00------1.00--1.001.00-1.00----1.002.00--1.00-1.00---8.001.001.00----------2.00------------4.00---2.00-----2.00--------2.00---------------------------------------1.00------------------------------1.00-----------------1.001.00----------------1.00-------
.................................................................................................GGAAATGATGATTATACTGAT....................................................................................................................................211106.00106.0021.001.0013.00-47.00-1.005.00--1.005.001.00--2.00-4.00-1.00---------------------------------1.00---------------------1.00-----------------------------------1.00--------------------------1.00-------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTA.................................................................................................................................251103.00103.0018.00-3.007.00-11.00-5.00-5.002.003.00-6.002.00--------2.002.001.001.00----3.00--2.00-6.003.00-----1.00--1.003.001.00-------1.00-3.00--1.00----1.00-------1.00----3.00-----------------1.001.00------1.00--------------1.00--------------------------------------------------------------------------------1.00----------------------
.................................................................................................GGAAATGATGATTATACTGA.....................................................................................................................................20199.0099.0027.004.004.008.0016.0024.006.004.00-------3.001.00---------------------1.00---------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTGAAA...........................................................................................................................30191.0091.00---8.0039.00-14.0014.00--2.004.00------1.003.00--------------------3.00-----1.00---2.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTG......................................................................................................................................19175.0075.009.0020.005.0013.009.008.00----------1.00--3.00--------2.00---------2.00---------------1.00-----2.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTA.................................................................................................................................24157.0057.003.00-3.00-2.00-20.0021.00--------1.00--------------1.00-1.00-------------------1.001.00----------------------1.00-------------------------1.00------------------------1.00-----------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTG......................................................................................................................................20149.0049.00-1.00-2.00--------2.00---------------35.00-------------------------------9.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGAT....................................................................................................................................22140.0040.00--4.00-4.00----1.00--6.001.001.00--------1.002.00----2.00--1.00--------1.00-1.001.00----------1.00----2.00----1.00-2.00--------------1.00-----2.00----2.001.00----------------------------1.00-------------------------------1.00--------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTTATT...................................................................................................................................22128.003.001.00---7.001.00--2.00-3.00----1.00-1.003.003.002.00------------------------------4.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................AATGATGATTATACTGATTT..................................................................................................................................20118.0018.00-1.00-2.00--6.004.00--------1.00-1.00---1.00---------------1.00---------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACT.......................................................................................................................................19116.0016.00-------------1.00--------------1.00------------------------------------------------5.00----4.00-4.00------------------------------------------------1.00------------------------------------------------------------------------------------------
..................................................................................................GAAATGATGATTATACTGATT...................................................................................................................................21112.0012.002.00--2.00----1.00------1.00-----1.00--------------------5.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTAA................................................................................................................................25110.0057.009.00---------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGCTT...................................................................................................................................22110.0075.001.001.00--2.00-----------2.002.00------------------------------------1.00--------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTAATT...................................................................................................................................2219.003.00-1.001.00---1.001.004.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGAGT...................................................................................................................................2218.0099.003.004.00---1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGA.....................................................................................................................................2118.008.00--------------------------1.00-1.00-------1.00------1.00-1.00-------------1.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------
....................................................................................................AATGATGATTATACTTATT...................................................................................................................................198.000.00-------1.00---------1.002.001.00------------------1.00------------2.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGACT...................................................................................................................................2218.0099.001.003.00-1.00--1.001.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTTATT...................................................................................................................................2318.0016.00--------------1.00---------1.00--1.001.00--1.00-----------1.001.00--1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................AAATGATGATTATACTGA.....................................................................................................................................1817.007.007.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................................................................ATGATGATTATACTGATT...................................................................................................................................1817.007.001.004.00-1.00----------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................AAATGATGATTATACTGATT...................................................................................................................................2016.006.00---1.003.00-----1.00-----------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGGTT...................................................................................................................................2215.0075.001.001.001.002.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGTTT...................................................................................................................................2215.0075.00-1.00-1.001.00-----------------------------1.00----------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTACTGAAA...........................................................................................................................3115.005.00----2.00-----------1.00-------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----
.................................................................................................GGAAATGATGATTATAC........................................................................................................................................1715.005.00--1.00------------3.00--------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACT...............................................................................................................................2614.004.00--2.00-------------------------------------------------------------------------------------1.00---------------------------------------------------------------1.00-----------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATC...................................................................................................................................2214.00106.00-1.001.00--1.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTAC................................................................................................................................2614.004.00------------------------1.00----------------------------------------1.00----------------1.00----------------------------------1.00----------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTCATT...................................................................................................................................2214.003.00-------1.002.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGCTT...................................................................................................................................2314.0049.00-------------------------1.00-----------------------------------------------------------------1.00------------1.00------------------------------------------------------------------------------------------------------------1.00----------
...........................................................................................................ATTATACTGATTTACTGAAA...........................................................................................................................2023.003.00----3.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATA...................................................................................................................................2213.00106.001.00------1.00-----------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACT.......................................................................................................................................1813.003.00--1.00---------------------------------------------------------------------------------2.00-------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATG...................................................................................................................................2213.00106.00-1.00-1.00--1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGTTT...................................................................................................................................2313.0049.00---------1.00-----------------1.00---------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................TTGGAAATGATGATTATACTGATT...................................................................................................................................2412.002.00----------------------------------1.00------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTGACA...........................................................................................................................302.000.00--------------------------------------------------1.00---------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTG..............................................................................................................................2712.002.00--2.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTT......................................................................................................................................1912.003.00----2.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................ATAGTTATTTTGTTGTTA.................................................................................................182.000.00----------------1.00-------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTGCAA...........................................................................................................................3012.002.00-------2.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................ATTATACTGATTTACTTAAA...........................................................................................................................202.000.00----2.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATA...................................................................................................................................2312.0040.00-------------1.00------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTAA................................................................................................................................2612.00103.00--------------1.00---------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGGTA...................................................................................................................................2211.0075.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTACTG..............................................................................................................................2811.001.00---------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTTCTT...................................................................................................................................2211.003.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....GATTTGGAGACTGAAGAC...................................................................................................................................................................................................................................181.000.00------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------
........................................................................................................ATGATTATACTGATTTACC...............................................................................................................................191.000.00-------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------
..................................................................................................GAAATGATGATTATACTG......................................................................................................................................1811.001.00------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTCAA................................................................................................................................2611.002304.00----------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATGCT.......................................................................................................................................191.000.00------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATAAA.......................................................................................................................................181.000.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGAA....................................................................................................................................2111.0099.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGAAT...................................................................................................................................2311.008.00--------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGAAT...................................................................................................................................2211.0099.00--------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTACT...............................................................................................................................2711.001.00-----------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................TTGGAAATGATGATTATACTGATTTA.................................................................................................................................2611.001.00--------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................AATGATGATTATACTAATT...................................................................................................................................191.000.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTCATT...................................................................................................................................2311.0016.00---------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACGG......................................................................................................................................1911.005.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................AATTCGGTTCCCTCAAAATT..............................2011.001.00---------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................AATGATGATTATACTGATTTACTGAAA...........................................................................................................................2711.001.00------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATTTACTGAAATTG........................................................................................................................3411.001.00-------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................AATTCGGTTCCCTCACCT................................181.000.00-------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTTAT....................................................................................................................................2211.0016.00------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
..........................................................................................................GATTATACTGATTTACTGAAA...........................................................................................................................2111.001.00-----------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTCAT....................................................................................................................................2111.003.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................................AGGAAAGCTCAAGACAAAGAA.2111.001.00------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------
...............................................................................................TTGGAAATGATGATTATACTGATTTAA................................................................................................................................2711.001.00--------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................TTGGAAATGATGATTATACTGATTTCC................................................................................................................................271.000.00----------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTACTT...................................................................................................................................2211.003.00---------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................................................................................................AGGCAGGAAAGCTCAAGACGAA....221.000.00----------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTGAAAT..........................................................................................................................3111.001.00----------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATATA.................................................................................................................................2511.0040.00--------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................................CAGGAAAGCTCAAGACAAAGA..2111.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------
................................................................................................TGGAAATGATGATTATACTGATTTAAA...............................................................................................................................2711.00103.00-----------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGATC...................................................................................................................................2311.0040.00---------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTTAT....................................................................................................................................2111.003.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................AAATGATGATTATACTG......................................................................................................................................1711.001.00------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATATTGA.....................................................................................................................................211.000.00-----------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................AATGATGATTATACTGAAT...................................................................................................................................191.000.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTTACTTAAA...........................................................................................................................3011.004.00------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTGAGT...................................................................................................................................2311.008.00---------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................GGAAATGATGATTATACTGATTAA.................................................................................................................................2411.006657.00------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................AATGATGATTATACTGAGT...................................................................................................................................191.000.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTTAGT...................................................................................................................................2311.0016.00---------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................TGGAAATGATGATTATACTT......................................................................................................................................2011.0016.00----------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.........................................................................................................................................................TTATTGAATGAAGTAGT................................................................................1740.250.25-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.25

Antisense strand
TTCTTGATTTGGAGACTGAAGATCACCTTGAATCTATGTGTCAAATGGGGTTGATTTTTTGCTAGGAATTTAAGTCTCAGAACCTTGGATTTTGGTTGGAAATGATGATTATACTGATTTACTGAAATTGACATAATAGTTATTTTGTTGAATTTATTGAATGAAGTAGTTGTAAAAACAATTCTATATATTTTCTTTAGAATTCGGTTCCCTCAAAATTATAAAGGCAGGAAAGCTCAAGACAAAGAAA
..................................................................................................((((((((.(((((..((((((....))))))..))))).))))))))........................................................................................................
............................................................................................93..............................................................157...........................................................................................
SizePerfect hitTotal NormPerfect NormSRR037943(GSM510481)
293DcrTN. (cell line)		SRR037941(GSM510479)
293DroshaTN. (cell line)		SRR363675(GSM830252)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		SRR037937(GSM510475)
293cand2. (cell line)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR037939(GSM510477)
293cand5_rep1. (cell line)		SRR037938(GSM510476)
293Red. (cell line)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR037935(GSM510473)
293cand3. (cell line)		SRR037936(GSM510474)
293cand1. (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR033713(GSM497058)
Burkitt Lymphoma (BL115). (B cell)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		SRR207116(GSM721078)
Nuclear RNA. (cell line)		SRR037931(GSM510469)
293GFP. (cell line)		SRR029127(GSM416756)
A549. (cell line)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR029125(GSM416754)
U2OS. (cell line)		DRR001489(DRX001043)
"Hela short nuclear cell fraction, control". (hela)		SRR029129(GSM416758)
SW480. (cell line)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR038861(GSM458544)
MM466. (cell line)		SRR033714(GSM497059)
Burkitt Lymphoma (BL134). (B cell)		SRR033718(GSM497063)
Multiple Myeloma (U266). (B cell)		SRR207112(GSM721074)
RRP40 knockdown. (RRP40 cell line)		SRR330868(SRX091706)
tissue: skin psoriatic involveddisease state:. (skin)		SRR033731(GSM497076)
h929 Cell line (h929). (B cell)		SRR038860(GSM458543)
MM426. (cell line)		SRR039190(GSM494809)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR033732(GSM497077)
bjab cell line (bjab103). (B cell)		SRR330865(SRX091703)
tissue: skin psoriatic involveddisease state:. (skin)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR039192(GSM494811)
K562 cell line is derived from a CML patient . (cell line)		SRR015447(SRR015447)
nuclear small RNAs. (breast)		SRR029124(GSM416753)
HeLa. (hela)		SRR033721(GSM497066)
Ly3 cell line (Ly3). (B cell)		SRR029128(GSM416757)
H520. (cell line)		SRR330877(SRX091715)
tissue: skin psoriatic involveddisease state:. (skin)		SRR363674(GSM830251)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR033716(GSM497061)
Mentle Cell Lymphoma (MCL114). (B cell)		SRR330870(SRX091708)
tissue: skin psoriatic involveddisease state:. (skin)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR060982(GSM569186)
Human centrocyte [09-001]. (cell line)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR029130(GSM416759)
DLD2. (cell line)		SRR037932(GSM510470)
293cand4_rep1. (cell line)		SRR038859(GSM458542)
MM386. (cell line)		SRR330878(SRX091716)
tissue: skin psoriatic involveddisease state:. (skin)		GSM416733(GSM416733)
HEK293. (cell line)		SRR330858(SRX091696)
tissue: skin psoriatic involveddisease state:. (skin)		SRR029131(GSM416760)
MCF7. (cell line)		SRR330864(SRX091702)
tissue: skin psoriatic involveddisease state:. (skin)		SRR060981(GSM569185)
Human centroblast [09-001]. (cell line)		SRR330889(SRX091727)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR390723(GSM850202)
total small RNA. (cell line)		SRR330861(SRX091699)
tissue: skin psoriatic involveddisease state:. (skin)		SRR033712(GSM497057)
Burkitt Lymphoma (BL510). (B cell)		SRR033715(GSM497060)
Mantle Cell Lymphoma (Mino122). (B cell)		SRR038863(GSM458546)
MM603. (cell line)		SRR015446(SRR015446)
smallRNAs high-throughput sequencing Total. (breast)		DRR001488(DRX001042)
"Hela short nuclear cell fraction, LNA(+)". (hela)		SRR038855(GSM458538)
D10. (cell line)		SRR107296(GSM677703)
18-30nt fraction of small RNA. (cell line)		SRR060168(GSM565978)
5-8F_nucleus. (cell line)		SRR326282(GSM769512)
"Dicer mRNA was knocked down using siDicer, t. (cell line)		SRR363673(GSM830250)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR326280(GSM769510)
total cell content of unperturbed cells was s. (cell line)		SRR060983(GSM569187)
Human pre-germinal center B cell [09-001]. (cell line)		SRR330879(SRX091717)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330872(SRX091710)
tissue: skin psoriatic involveddisease state:. (skin)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330873(SRX091711)
tissue: skin psoriatic involveddisease state:. (skin)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR330880(SRX091718)
tissue: skin psoriatic involveddisease state:. (skin)		TAX577745(Rovira)
total RNA. (breast)		SRR094129(GSM651905)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330857(SRX091695)
tissue: skin psoriatic involveddisease state:. (skin)		SRR094132(GSM651908)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR038854(GSM458537)
MM653. (cell line)		SRR330871(SRX091709)
tissue: skin psoriatic involveddisease state:. (skin)		SRR189784SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		SRR330863(SRX091701)
tissue: skin psoriatic involveddisease state:. (skin)		SRR029126(GSM416755)
143B. (cell line)		SRR330859(SRX091697)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330862(SRX091700)
tissue: skin psoriatic involveddisease state:. (skin)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR330921(SRX091759)
tissue: normal skindisease state: normal. (skin)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		SRR033717(GSM497062)
Mentle Cell Lymphoma (MCL112). (B cell)		SRR330923(SRX091761)
tissue: normal skindisease state: normal. (skin)		SRR191631(GSM715741)
75genomic small RNA (size selected RNA from t. (breast)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR038858(GSM458541)
MEL202. (cell line)		SRR330860(SRX091698)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330902(SRX091740)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR038856(GSM458539)
D11. (cell line)		SRR038862(GSM458545)
MM472. (cell line)		SRR191607(GSM715717)
192genomic small RNA (size selected RNA from . (breast)		SRR330867(SRX091705)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191614(GSM715724)
92genomic small RNA (size selected RNA from t. (breast)		SRR015359(GSM380324)
Germinal Center B cell (GC136). (B cell)		SRR107297(GSM677704)
18-30nt fraction of small RNA. (cell line)		SRR191590(GSM715700)
48genomic small RNA (size selected RNA from t. (breast)		SRR191608(GSM715718)
193genomic small RNA (size selected RNA from . (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		SRR037876(GSM522374)
fibroblasts_cell_culture. (fibroblast)		TAX577739(Rovira)
total RNA. (breast)		SRR343335SRR038857(GSM458540)
D20. (cell line)		SRR330876(SRX091714)
tissue: skin psoriatic involveddisease state:. (skin)		SRR039611(GSM531974)
Human Normal Liver Tissue Sample 1. (liver)		SRR038852(GSM458535)
QF1160MB. (cell line)		GSM359208(GSM359208)
hepg2_bindASP_hl_2. (cell line)		SRR039614(GSM531977)
HBV-infected Liver Tissue. (liver)		SRR094130(GSM651906)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR191599(GSM715709)
89genomic small RNA (size selected RNA from t. (breast)		SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR207118(GSM721080)
RRP40 knockdown. (RRP40 cell line)		SRR191606(GSM715716)
84genomic small RNA (size selected RNA from t. (breast)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191610(GSM715720)
195genomic small RNA (size selected RNA from . (breast)		SRR039612(GSM531975)
Human Normal Liver Tissue Sample 2. (liver)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR015365(GSM380330)
Memory B cells (MM139). (B cell)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039613(GSM531976)
Human Normal Liver Tissue Sample 3. (liver)		GSM541796(GSM541796)
undifferentiated human embryonic stem cells. (cell line)		SRR033730(GSM497075)
Lymphoblastic (ALL411). (B cell)		TAX577453(Rovira)
total RNA. (breast)		SRR330916(SRX091754)
tissue: normal skindisease state: normal. (skin)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR189781(GSM714641)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR343334SRR033719(GSM497064)
6hr Activated B cell line (ABC158). (B cell)		SRR191488(GSM715598)
14genomic small RNA (size selected RNA from t. (breast)		SRR029054(GSM402329)
MCF7_smallRNAseq. (cell line)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR191555(GSM715665)
195genomic small RNA (size selected RNA from . (breast)		SRR330908(SRX091746)
tissue: normal skindisease state: normal. (skin)		SRR330914(SRX091752)
tissue: normal skindisease state: normal. (skin)		SRR330881(SRX091719)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		SRR330913(SRX091751)
tissue: normal skindisease state: normal. (skin)		SRR342894(SRX096790)
small RNA seq of Right atrial tissue. (heart)		SRR191435(GSM715545)
172genomic small RNA (size selected RNA from . (breast)		SRR553575(SRX182781)
source: Kidney. (Kidney)		SRR191586(GSM715696)
197genomic small RNA (size selected RNA from . (breast)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR191468(GSM715578)
116genomic small RNA (size selected RNA from . (breast)		GSM532880(GSM532880)
G659T. (cervix)		SRR330922(SRX091760)
tissue: normal skindisease state: normal. (skin)		SRR330890(SRX091728)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191482(GSM715592)
5genomic small RNA (size selected RNA from to. (breast)		SRR326279(GSM769509)
cytoplasmic fraction was isolated using PARIS. (cell line)		SRR191492(GSM715602)
154genomic small RNA (size selected RNA from . (breast)		SRR330891(SRX091729)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191577(GSM715687)
93genomic small RNA (size selected RNA from t. (breast)		SRR191493(GSM715603)
155genomic small RNA (size selected RNA from . (breast)		SRR191444(GSM715554)
109genomic small RNA (size selected RNA from . (breast)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR444049(SRX128897)
Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR040023(GSM532908)
G575T. (cervix)		SRR330911(SRX091749)
tissue: normal skindisease state: normal. (skin)		SRR015358(GSM380323)
NaÌøve B Cell (Naive39). (B cell)		SRR039617(GSM531980)
HBV(+) Adjacent Tissue Sample 1. (liver)		SRR189785SRR330897(SRX091735)
tissue: skin psoriatic uninvolveddisease stat. (skin)		GSM359193(GSM359193)
HepG2_3pM_7. (cell line)		SRR330875(SRX091713)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		SRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		SRR330887(SRX091725)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR033727(GSM497072)
HIV-positive DL (HIV412). (B cell)		TAX577741(Rovira)
total RNA. (breast)		SRR191495(GSM715605)
159genomic small RNA (size selected RNA from . (breast)		SRR330919(SRX091757)
tissue: normal skindisease state: normal. (skin)		SRR363676(GSM830253)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR330901(SRX091739)
tissue: skin psoriatic uninvolveddisease stat. (skin)		TAX577742(Rovira)
total RNA. (breast)		SRR033720(GSM497065)
EBV activated B cell line (EBV159). (B cell)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		TAX577589(Rovira)
total RNA. (breast)		SRR060169(GSM565979)
5-8F_cytoplasm. (cell line)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR330915(SRX091753)
tissue: normal skindisease state: normal. (skin)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191585(GSM715695)
196genomic small RNA (size selected RNA from . (breast)		SRR015360(GSM380325)
Plasma B cells (PC137). (B cell)		SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR038853(GSM458536)
MELB. (cell line)		SRR191458(GSM715568)
28genomic small RNA (size selected RNA from t. (breast)		SRR330866(SRX091704)
tissue: skin psoriatic involveddisease state:. (skin)		SRR342898(SRX096794)
small RNA seq of Right atrial tissue. (heart)		SRR191601(GSM715711)
58genomic small RNA (size selected RNA from t. (breast)		SRR015361(GSM380326)
Memory B cells (MM55). (B cell)		SRR191562(GSM715672)
82genomic small RNA (size selected RNA from t. (breast)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR330895(SRX091733)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039637(GSM518474)
THP1_total_sRNAs. (cell line)		SRR191497(GSM715607)
17genomic small RNA (size selected RNA from t. (breast)		SRR039624(GSM531987)
HBV(-) HCV(-) Adjacent Tissue Sample. (liver)		SRR207119(GSM721081)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		TAX577743(Rovira)
total RNA. (breast)		SRR191413(GSM715523)
28genomic small RNA (size selected RNA from t. (breast)		SRR189778(GSM714638)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR444060(SRX128908)
Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin)
...........................................................................................................................................................................................ATATTTTCTTTAGAATTG............................................. 184.000.00--------------------------------------------------------------------------------------------------------------------3.00-----------------------------1.00-----------------------------------------------------------------------------
........................................................................................ATTTTGGTTGGAAATGAATG.............................................................................................................................................. 202.000.00---------------------------------------------------------------------------------------2.00----------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................AAAATTATAAAGGCATAA.................. 181.000.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------
.............................................................................................................................................................................................................GGTTCCCTCAAAATTTAC........................... 181.000.00-------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------
..............................................................................................................................................TTTTGTTGAATTTATTAGG......................................................................................... 191.000.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------
..............................................................................................................................................TTTTGTTGAATTTATTGAACC....................................................................................... 211.000.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------
......................................................................................................................................................................................................................AAAATTATAAAGGCATAAG................. 191.000.00---------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................................................................................GTTCCCTCAAAATTAATTT......................... 191.000.00---------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................TTTTTACAACTACTTCA........................................................................ 1730.330.33------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.33-
..............................................................................................................................................CAATAAATTCAACAAAA........................................................................................... 1770.140.14----------------------------------------------------------------------------------------------------------0.14---------------------------------------------------------------------------------------------------------------------